Should the role of race and racism in infant mortality shape priority setting and the allocation of resources in public health? If so, why?

Department of Internal Medicine and Department of Health Management
and Policy Center for Bioethics and Social Sciences in Medicine
University of Michigan
Ann Arbor , Michigan , USA

This case is presented for instructional purposes only. The ideas and opinions expressed
are the authors’ own. The case is not meant to refl ect the offi cial position, views, or
policies of the editors, the editors’ host institutions, or the authors’ host institutions.

3.8.1 Background

Preterm births, the leading cause of infant mortality, are increasing annually worldwide
(World Health Organization 2012 ). The United State s shares company with Nigeria,
India, and Brazil among the top ten countri es with the highest numbers of preterm births
and ranks 31st among Organisation for Economic Co-operation and Development (OECD)
nations in infant mortality (OECD 2010 ). Within the United States, racial and ethnic
disparities in infant mortality remain entrenched and have increased (MacDorman and
Mathews 2009 ). U.S. health policy leaders have made the elimination of health dispari-
ties a top public health priority (Centers for Disease Control and Prevention 2011 ;
U.S. Department of Health and Human Services 2011 ). Infant mortality is an important
area of focus for eliminating disparities, both in its own right and because the rate of
infant mortality serves as an indicator of the nation’s health due to its association with
maternal health, social and economic conditions, racial discrimination, access to health
care, and public health practices (MacDorman and Mathews 2009 ).

During the twentieth century, U.S. infant mortality declined 93 % (MacDorman
2011 ). In 1900, about 100 infants died per 1000 live births. By 2000, that number
fell to 6.89. During the last half of the twentieth century, the rate of black infant
mortality dropped dramatically. In 1950, black infant mortality was 43.9 deaths per
1000 live births compared with 26.8 deaths per 1000 live births among whites
(Mechanic 2002 ). But by 1998 black infant mortality fell to 13.8 deaths per 1000
live births compared with 6.0 deaths per 1000 live births among whites. As these
numbers show, both groups made signifi cant absolute gains, with blacks gaining
more in absolute terms—a reduction of 30.1 for blacks and 20.8 for whites. Yet,
black infant mortality still remained about twice that of whites.

N. Daniels

85

These disparities have persisted in the twenty-fi rst century. In 2006, non- Hispanic
black women experienced the highest rate of infant mortality, with 13.4 infant
deaths per 1000 live births, while non-Hispanic white women had a considerably
lower rate, with 5.6 infant deaths per 1000 live births. Citing a 2006 report from the
National Healthy Start Association, MacDorman and Mathews ( 2009 ) report that
programmatic efforts to reduce disparities in black-white infant mortality have had
some successes at local levels, but eliminating the disparities is diffi cult.

The U.S. Centers for Disease Control and Prevention and the U.S. Department of
Health and Human Services have prioritized both the elimination of health dispari-
ties and improvement in overall population health. These twin goals—one distribu-
tive, the other aggregative—are separate and sometimes confl ict (Anand 2004 ).
Increases in health disparities often accompany advances in aggregate gains in popu-
lation health (Mechanic 2007 ). Although this case is specifi c to the United State s, the
dilemma is not. Data show that signifi cant progress on child mortality has been made
in many countries but that this overall success is often coupled with increased
inequalities between advantaged and disadvantaged groups (Chopra et al. 2012 ). In
China and India, for example, disparities in mortality persist between boys and girls
younger than 5 years, a function of entrenched gender discrimination (You et al.
2010 ). These examples raise challenging questions about how ethically to assess
such cases and set priorities for the allocation of scarce public health resources.

3.8.2 Case Description

You serve as the director for the local health department in a racially segregated
urban city in the Midwest with one of the greatest concentrations of African
Americans in the United States. The city has a long history of civil rights activism
that led to protests and marches that ultimately empowered and mobilized black
communities and organizations. Your health department has a history of prioritizing
maternal-child health and the elimination of black-white disparities in infant mor-
tality in its programs, an investment of resources affi rmed by the city residents
through the department’s community outreach program and planning processes.

Chronic underfunding of public health, made worse by the economic downturn,
has resulted in drastic and unprecedented reductions in the public health budget. In
consultation with your staff and community board of health, you have raised the
possibility of redirecting resources from maternal-child health into other programs
based on a number of practical and ethical considerations. As with national statis-
tics, the city has seen signifi cant declines in black infant mortality, even as black-
white disparities remain. You note that although the maternal-child health programs
are cost-effective, their impact on reducing black-white disparities seems to have
stalled. Other programs appear to meet targets more consistently. To help support
these other programs, you note that allocating resources to more effective programs
provides more “health” per dollar, thus meeting the utilitarian demand to maximize
overall health, which many view as the primary goal of public health and health
policy (Powers and Faden 2006 ). In addition, although black-white disparities in

3 Resource Allocation and Priority Setting

86

infant mortality persist, blacks have made signifi cant gains, declining more than
whites in some decades. You note that remaining inequalities could be deemed ethi-
cally acceptable by some standard s of equity , such as the “maximin” principle .
Although this distributive principle is subject to interpretation (Van Parijs 2003 ), it
is generally understood to require that social and economic inequalities work to
benefi t society’s least advantaged groups. Thus, inequalities (even signifi cant ones)
are morally acceptable as long as the least advantaged have signifi cantly benefi ted
(Powers and Faden 2006 ).

The director of community outreach proposes that the health department not
make this decision unilaterally, but instead listen to community opinions on these
questions of priorities and fairness. He suggests that the health department collabo-
rate with community partners to host a series of public forums. He insists that a
topic of such historic and contemporary concern to the community must be subject
to public deliberation. Despite having a history of supporting community discus-
sions, you are concerned about the cost of community forums, noting that they will
drain resources from an already slim budget.

3.8.3 Discussion Questions

1. Have local health departments met their ethical obligations when community
health improves overall, but health disparities persist? If not, why not? If so, on
what grounds?

2. Is there something about infant mortality that makes it special in considerations
of fairness? If so, what is it?

3. Should the role of race and racism in infant mortality shape priority setting and
the allocation of resources in public health? If so, why?

4. On what grounds and how should you as the local health department director
make resource allocation decisions? What standard s—evidence, principle s of
justice , public opinion—should infl uence priority setting?

5. Should the community have a role in identifying community health priorities or,
more specifi cally, in providing input into allocation decisions that directly affect
them? If so, how should the community be involved and who represents the
community?

References

Anand, S. 2004. The concern for equity in health. In Public health, ethics, and equity , ed. S.
Anand, F. Peter, and A. Sen, 15–20. New York: Oxford University Press.

Centers for Disease Control and Prevention. 2011. About CDC’s Offi ce of Minority Health &
Health Equity (OMHHE). http://www.cdc.gov/minorityhealth/OMHHE.html . Accessed 29 Apr
2013.

N. Daniels

87

Chopra, M., H. Campbell, and I. Rudan. 2012. Understanding the determinants of the complex
interplay between cost-effectiveness and equitable impact in maternal and child mortality
reduction. Journal of Global Health 2(1): 1–10.

MacDorman, M.F. 2011. Infant deaths—United States, 2000–2007. MMWR Supplement 60:
49–51.

MacDorman, M.F., and T.J. Mathews. 2009. The challenge of infant mortality: Have we reached a
plateau? Public Health Reports 124(5): 670–681.

Mechanic, D. 2002. Disadvantage, inequality, and social policy. Health Affairs 21(2): 48–59.
Mechanic, D. 2007. Population health: Challenges for science and society. The Milbank Quarterly

85(3): 533–559.
Organisation for Economic Co-operation and Development (OECD). 2010. OECD health data:

Infant mortality. https://data.oecd.org/healthstat/infant-mortality-rates.htm . Accessed 25 May
2015.

Powers, M., and R. Faden. 2006. Social justice: The moral foundations of public health and health
policy. New York: Oxford University Press.

U.S. Department of Health and Human Services. 2011. HHS action plan to reduce racial and
ethnic health disparities. http://www.minorityhealth.hhs.gov/npa/templates/content.
aspx?lvl=1&lvlid=33&ID=285 . Accessed 25 May 2015.

Van Parijs, P. 2003. Difference principles. In The Cambridge companion to Rawls , ed. S. Freeman,
200–240. Cambridge: Cambridge University Press.

World Health Organization (WHO). 2012. Born too soon: The global action report on preterm birth.
http://whqlibdoc.who.int/publications/2012/9789241503433_eng.pdf . Accessed 29 Apr 2013.

You, D., G. Jones, T. Wardlaw, and M. Chopra. 2010. Levels and trends in child mortality, 1990–
2009. Lancet 376(9745): 931–933.

3.9 Case 5: Priority Setting in Healt h Care: Ethical Issues

M. Inés Gómez and Lorna Luco
Centro de Bioética, Facultad de Medicina
Clínica Alemana–Universidad del Desarrollo
Santiago , Chile
e-mail: [email protected]

This case is presented for instructional purposes only. The ideas and opinions
expressed are the authors’ own. The case is not meant to refl ect the offi cial position,
views, or policies of the editors, the editors’ host institutions, or the authors’ host
institutions.

3.9.1 Background

The Chilean Sy stem of Guarantees in Health—created by law in 2004—aims to
establish guaranteed health care interventions in health promotion, disease and
injury prevention , diagnosis and treatment , rehabilitation and palliative care
(Ministerio de Salud 2004 ). The law mandates that public and private insurers pro-
vide the resources needed to protect the public against excessive health-related

3 Resource Allocation and Priority Setting

You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?C

1) You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?Compare the area and total dynamic read energy per access of the pipelined design versus the banked design. State which takes up less area and which requires more power and explain why that might be.2) A cache acts as a filter. For example, for every 1000 instructions of a program, an average of 20 memory accesses may exhibit low enough locality that they cannot be serviced by a 2 MB cache. The 2 MB cache is said to have an MPKI (misses per thousand instructions) of 20, and this will be largely true regardless of the smaller caches that precede the 2 MB cache. Assume the following cache/latency/MPKI values: 32 KB/1/100, 128 KB/2/80, 512 KB/4/50, 2 MB/8/40, 8 MB/16/10. Assume that accessing the off-chip memory system requires 200 cycles on average. For the following cache configurations, calculate the average time spent accessing the cache hierarchy. What do you observe about the downsides of a cache hierarchy that is too shallow or too deep?a. 32 KB L1; 8 MB L2; off-chip memoryb. 32 KB L1; 512 KB L2; 8 MB L3; off-chip memoryc. 32 KB L1; 128 KB L2; 2 MB L3; 8 MB L4; off-chip memory3) You are designing a PMD and optimizing it for low energy. The core, including an 8 KB L1 data cache, consumes 1 W whenever it is not in hibernation. If the core has a perfect L1 cache hit rate, it achieves an average CPI of 1 for a given task, that is, 1000 cycles to execute 1000 instructions. Each additional cycle accessing the L2 and beyond adds a stall cycle for the core. Based on the following specifications, what is the size of L2 cache that achieves the lowest energy for the PMD (core, L1, L2, memory) for that given task?The core frequency is 1 GHz, and the L1 has an MPKI of 100.A 256KB L2 has a latency of 10cycles, an MPKI of 20, a background power of 0.2 W, and each L2 access consumes 0.5 nJ.A 1MB L2 has a latency of 20 cycles, an MPKI of 10, a background power of 0.8 W, and each L2 access consumes 0.7 nJ.The memory system has an average latency of 100 cycles, a background power of 0.5 W, and each memory access consumes 35 nJ.4) The ways of a set can be viewed as a priority list, ordered from high priority to low priority. Every time the set is touched, the list can be reorganized to change block priorities. With this view, cache management policies can be decomposed into three sub-policies: Insertion, Promotion, and Victim Selection. Insertion defines where newly fetched blocks are placed in the priority list. Promotion defines how a block’s position in the list is changed every time it is touched (a cache hit). Victim Selection defines which entry of the list is evicted to make room for a new block when there is a cache miss.a. Can you frame the LRU cache policy in terms of the Insertion, Promotion, and Victim Selection sub-policies?b. Can you define other Insertion and Promotion policies that may be competitive and worth exploring further?5) You are trying to appreciate how important the principle of locality is in justifying the use of a cache memory, so you experiment with a computer having an L1 data cache and a main memory (you exclusively focus on data accesses). The latencies (in CPU cycles) of the different kinds of accesses are as follows: cache hit, 1 cycle; cache miss, 110 cycles; main memory access with cache disabled, 105 cycles.When you run a program with an overall miss rate of 3%, what will the average memory access time (in CPU cycles) be?Next, you run a program specifically designed to produce completely random data addresses with no locality. Toward that end, you use an array of size 1 GB (all of which fits in the main memory). Accesses to random elements of this array are continuously made (using a uniform random number generator to generate the elements indices). If your data cache size is 64 KB, what will the average memory access time be?If you compare the result obtained in part (b) with the main memory access time when the cache is disabled, what can you conclude about the role of the principle of locality in justifying the use of cache memory?You observed that a cache hit produces a gain of 104 cycles(1 cycle vs. 105), but it produces a loss of 5 cycles in the case of a miss (110 cycles vs. 105). In the general case, we can express these two quantities as G (gain) and L (loss). Using these two quantities (G and L), identify the highest miss rate after which the cache use would be disadvantageous.

Nursing lab assignment: differential diagnosis for skin conditions

SkinComprehensiveSOAPNoteTemplate.docx

Week 4

Skin Comprehensive SOAP Note Template

Patient Initials: _______ Age: _______ Gender: _______

SUBJECTIVE DATA:

Chief Complaint (CC):

History of Present Illness (HPI):

Medications:

Allergies:

Past Medical History (PMH):

Past Surgical History (PSH):

Sexual/Reproductive History:

Personal/Social History:

Health Maintenance:

Immunization History:

Significant Family History:

Review of Systems:

General:

HEENT:

Respiratory:

Cardiovascular/Peripheral Vascular:

Gastrointestinal:

Genitourinary:

Musculoskeletal:

Neurological:

Psychiatric:

Skin/hair/nails:

OBJECTIVE DATA:

Physical Exam:

Vital signs:

General:

HEENT:

Neck:

Chest/Lungs:.

Heart/Peripheral Vascular:

Abdomen:

Genital/Rectal:

Musculoskeletal:

Neurological:

Skin:

Diagnostic results:

ASSESSMENT:

PLAN:
This section is not required for the assignments in this course (NURS 6512), but will be required for future courses.

© 2021 Walden University Page 2 of 3

week4intrototheassignment.PNG

week4preparingtheassignment.PNG

This exercise should help you see how this tool can be applied to forensic and paternity testing. The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

Lab 10: Paternity Testing with DNA Fingerprinting

Name: ____________________

Introduction

DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.
The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.
1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
2. You have been given the following DNA samples:

Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG

Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG

Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG

Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary’s DNA as an example.
4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.
5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?
6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.
7.
8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.
9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?

10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

What role do you think psychologists can play in promoting preventive interventions and helping individuals stay healthy? How can their expertise contribute to addressing challenges and obstacles to maintaining a healthy lifestyle?

 In response to your peers, please aim for at least one paragraph that provides additional information, a different perspective, or a follow-up question related to their post. Maintain a respectful and supportive tone, acknowledging and appreciating their contributions. The goal is to engage in a collaborative learning environment, allowing everyone to explore the topic further and deepen their understanding of the subject matter. 
 
1#  I think it is pretty important for psychologists to treat and help people stay healthy in many scenerios. While I don’t believe that psychologists should be primary care doctors or anyhting, I think that they can be very helpful in noticing and helping prevent future problems that may arise that are noticed during sessions. They should always be trying to promote healthier routes for their clients and suggest changes that may help them out in the long run. When the health problems seem to stem from psychological related issues is I think when it is really important for psychologists to be able to truly try and help out. 
       There can be numerous things that make it hard for people to try and stay “healthy”. Many people may feel like they lack the time to go out and be active and try and stay in shape, while others may feel like trying to be healthy is just too much and overwhelming. (Alexander 2020) These can have negative affects on the mind and make it hard for people to stay healthy or even try to in their standards. Being in a state of learned helplessness may only make matters worse because someone may not even try to make changes when it is entirely possible to. Things so simple as just taking a walk can be difficult as they don’t feel like they can control anything that happens to them. 
       Some things that I like to do to try and stay healthy and in shape are going for brisk walks around sunset right after I eat dinner, and taking some time for myself mentally at the end of each day, or in the morning before I begin my day. These help me feel more in control of what I do and make me feel as if I have purpose and self care in life. Another thing I do to try and stay healthy is join some recreational adult sports leagues to just keep in shape and have fun while doing it. 
 
2# Psychologists play a crucial role in treating mental health problems and promoting overall well-being. Additionally, their efforts to prevent problems and help people stay healthy are equally important. One research article that supports this idea is “The Prevention of Mental Disorders in School-Aged Children: Current State of the Field” by Fazel, Hoagwood, Stephan, and Ford (2014). The article highlights the significance of preventive interventions in schools to address mental health issues among children and adolescents. Challenges to staying healthy can vary among individuals, but two common obstacles are lack of motivation and limited access to resources. Motivation can diminish when individuals feel overwhelmed or lack a clear understanding of the benefits of healthy habits. Limited access to resources, such as healthy food options or safe exercise environments, can also hinder efforts to stay healthy. Learned helplessness can indeed make it harder to stay healthy. When individuals believe they have no control over their health outcomes, they may feel discouraged and less likely to engage in healthy behaviors. This mindset can lead to a lack of initiative to make positive changes and maintain a healthy lifestyle. Another obstacle to staying healthy is the presence of unhealthy environmental cues. Surroundings that promote unhealthy habits, such as easy access to junk food or a sedentary lifestyle, can undermine efforts to stay healthy. The constant exposure to such cues can create a challenging environment that makes it harder to adopt and maintain healthy behaviors. To stay healthy, individuals can consider incorporating two strategies: regular physical activity and maintaining a balanced diet. Engaging in regular exercise has been extensively studied and shown to have numerous physical and mental health benefits. It can help manage weight, reduce the risk of chronic diseases, improve mood, and enhance overall well-being. Similarly, maintaining a balanced diet that includes nutrient-rich foods supports optimal health and can prevent various health conditions. Practicing mindfulness meditation is a strategy that many people find beneficial for their well-being. Research suggests that mindfulness meditation can reduce stress, improve focus, and enhance overall mental health. Numerous studies have shown its effectiveness in reducing anxiety, depression, and improving overall psychological well-being. Every individual’s experiences may vary, and it’s always recommended to consult with healthcare professionals for personalized advice.
Question: What role do you think psychologists can play in promoting preventive interventions and helping individuals stay healthy? How can their expertise contribute to addressing challenges and obstacles to maintaining a healthy lifestyle?

At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood.  A. What is your plan? This is a shelter in place scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.

See Rubric for additional details.

Your paper should address the following:

Title Page

Introduction – Family Disaster Plan Scenario

A. You must include research on the dangers and explain the recommended safety measures in a tornado emergency.

How would you prepare for the following situation?

(Scenario) At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood. 

A. What is your plan? This is a ‘shelter in place’ scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.
B. Provide realistic examples and explain how you would apply the safety and survival measures you learned in your research of a tornado emergency to your specific living arrangements.

Example: “I will turn off my utilities before I shelter in place to mitigate damage to my residence.”

Example: “I will take by “go-bags” with me to my shelter in place.

How prepared are you in the event of a disaster?

A. Describe your level of disaster preparedness using specific examples and references to:
1. Potential disasters in your area.
2. Your 72 hour “go-bag” assignment.
3. Family Disaster Plan Checklist.

Example: “I am more prepared for a water-related disaster than a fire-related disaster even though I live in a highly secluded, forested area. I have a boat as transportation in the event of flooding, but I do not have rain barrels or fire barrier supplies on hand.”

Example:  “There were many missing items on my preparedness checklist. I realized that I do not own a flashlight. If I had to use my phone as a light it would drain the battery very quickly. 

Reflection/Conclusion

A. Reflect on how prepared you were before this class and compare it with how prepared you are now. 
· Have you acquired any new emergency items?
· Do you plan to take any additional training or certification courses?
· Have you shared your knowledge with friends and family? 
B. How does what you have learned in this course impact you as a future nurse?

Reference Page

A. Cite and reference at least two (2) scholarly resources using 7th ed APA format.
· Need help with APA Style?  Visit the 

Student Resources
 page

.

2

Beefsteak is a fast-casual restaurant concept from acclaimed Chef José Andrés that focuses on the “unsung power of vegetables” (Beefsteak Company Background Packet, . What key characteristics should Beefsteak recruiters look for in candidates, especially with regard to how someone will fit into the company culture?

 
Prior to beginning work on this final presentation,
For this class, The Beefsteak Reinforcing Culture Through Human Capital Development Case Study Analysis final presentation assignment will apply toward Folio.
Scenario
Beefsteak is a fast-casual restaurant concept from acclaimed Chef José Andrés that focuses on the “unsung power of vegetables” (Beefsteak Company Background Packet, n.d., page 7). hat key characteristics should Beefsteak recruiters look for in candidates, especially with regard to how someone will fit into the company culture?José Andrés is a world-renowned chef and owner of a number of restaurants. He was nominated for the 2019 Nobel Peace Prize for his work with disaster relief through his nonprofit organization World Central Kitchen. Andrés’s mission is to change the world through the power of food. Jim Biafore, Senior Director for Beefsteak, knows that culture—much like any good business—is forever changing, adapting to its environment. As Beefsteak grows, he sees the need to develop employees not only for return on investment, but also for maintenance of the culture and values espoused from the larger organization, ThinkFoodGroup. Beefsteak needs to develop programs to develop its employees in line with the company’s mission and strategic direction.
Assume the role of a Beefsteak consultant dedicated to creating and reinforcing the company’s ideal culture. Jim Biafore wants you to assess Beefsteak’s current company culture, determine ways that it can be improved, forecast potential changes through growth, and provide a plan for sustaining cultural longevity through employees.
Using the materials provided to you, as well as at least two to three additional resources pertaining to human resource management, prepare a PowerPoint presentation with audio on the proposal for a strategic human capital development program focused on the transmission of company core values. You may use the University of Arizona Global Campus resource, Presentation TipsLinks to an external site., for assistance on adding audio to your presentation.
To communicate with Beefsteak’s Jim Biafore and executive team, you will present your analysis using PowerPoint with audio. The analysis should be six to eight slides. The strategic human capital analysis should reinforce the culture through

recruitment
training
retention
team development
organizational responsibility

The analysis should also consider Week 4’s contemporary human capital topic and predictive analysis.
Consider the following questions as you prepare your analysis:

What might you infer about Beefsteak’s current company culture? Does it have elements of organizational responsibility?
What key characteristics should Beefsteak recruiters look for in candidates, especially with regard to how someone will fit into the company culture?
How does job training and employee development differ from a cultural standpoint?
What motivates individuals or employees to believe in a cause?
What do employees want out of development programs?
What about employee development programs benefits the company?
Why is it important to think about employee development at this stage?
What contemporary human capital issues might you consider at Beefsteak?
Is it possible to use some predictive analysis technique?
How might things differ if Beefsteak expands globally rather than just in the U.S.?
How do you plan to measure the success/failure of your culture strategy? What steps will you take to ensure that the culture is shifting and/or being reinforced in that way that you intend?

In this presentation analysis,

Determine ways to improve the company’s culture in a growth environment.
Assess and make recommendations regarding the company’s recruiting, training, development, and retention strategies.
Integrate contemporary human capital topics and predictive analysis.
Discuss potential global expansion on the company culture and success.
Formulate an overall organized and concise proposal for the company’s ideal culture supported through human resource management.

The Beefsteak Reinforcing Culture Through Human Capital Development Case Study Analysis Audio PowerPoint presentation

Must be six to eight slides in length (not including title and references slides) and formatted according to APA StyleLinks to an external site. as outlined in the Writing Center’s How to Make a PowerPoint PresentationLinks to an external site. resource.
Must include a separate title slide with the following:

Title of the proposal
Student’s name
Course name and number

Instructor’s name
Date submitted
Must use two scholarly and/or credible sources in addition to the course text and Beefsteak case study.

Must document any information used from sources in APA Style as outlined in the Writing Center’s APA: Citing Within Your PaperLinks to an external site. guide.

Avoid over-dependence on direct quotes. Direct quotes are a great way to strengthen our assertions and provide support. However, be sure to avoid using excessive direct quotes in lieu of original thought. Direct quotes will not meet the requirement for analysis, application, and critical thinking. Please ensure to not overuse direct quote so that you can avoid losing points for this. Review the Integrating ResearchLinks to an external site. resource from the Writing Center for additional guidance.

Must include a separate reference slide that is formatted according to APA Style as outlined in the Writing Center. See the APA: Formatting Your References ListLinks to an external site. resource in the Writing Center for specifications.

Case Study: A Middle-Aged Caucasian Man With Anxiety. You will be asked to make three decisions concerning the medication to prescribe to this patient. Be sure to consider factors that might impact the patient’s pharmacokinetic and pharmacodynamic processes.

Case Study:

https://cdn-media.waldenu.edu/2dett4d/Walden/NURS/6630/DT/week_05/index.html

Examine
 Case Study: A Middle-Aged Caucasian Man With Anxiety. You will be asked to make three decisions concerning the medication to prescribe to this patient. Be sure to consider factors that might impact the patient’s pharmacokinetic and pharmacodynamic processes.

At each decision point, you should evaluate all options before selecting your decision and moving throughout the exercise. Before you make your decision, make sure that you have researched each option and that you evaluate the decision that you will select. Be sure to research each option using the primary literature.

Introduction to the case (1 page)

· Briefly explain and summarize the case for this Assignment. Be sure to include the specific patient factors that may impact your decision making when prescribing medication for this patient.

Decision #1 (1 page)

· Which decision did you select?
· Why did you select this decision? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· Why did you not select the other two options provided in the exercise? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources (including the primary literature).
· Explain how ethical considerations may impact your treatment plan and communication with patients. Be specific and provide examples.

Decision #2 (1 page)

· Why did you select this decision? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· Why did you not select the other two options provided in the exercise? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources (including the primary literature).
· Explain how ethical considerations may impact your treatment plan and communication with patients. Be specific and provide examples.

Decision #3 (1 page)

· Why did you select this decision? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· Why did you not select the other two options provided in the exercise? Be specific and support your response with clinically relevant and patient-specific resources, including the primary literature.
· What were you hoping to achieve by making this decision? Support your response with evidence and references to the Learning Resources (including the primary literature).
· Explain how ethical considerations may impact your treatment plan and communication with patients. Be specific and provide examples.

Conclusion (1 page)

· Summarize your recommendations on the treatment options you selected for this patient. Be sure to justify your recommendations and support your response with clinically relevant and patient-specific resources, including the primary literature.
References:
· Stahl, S. M. (2021). Stahl’s essential psychopharmacology: Neuroscientific basis and practical applications (5th Ed.) Cambridge University Press.
· Chapter 8,  “Anxiety, Trauma, and Treatment” (pp. 359-378)
· American Psychiatric Association. (2010a). 

Practice guideline for the treatment of patients with acute stress disorder and posttraumatic stress disorder
Links to an external site.
. https://psychiatryonline.org/pb/assets/raw/sitewide/practice_guidelines/guidelines/acutestressdisorderptsd.pdf

· American Psychiatric Association. (2010c). 

Practice guideline for the treatment of patients with panic disorder
Links to an external site.
 (2nd ed.). https://psychiatryonline.org/pb/assets/raw/sitewide/practice_guidelines/guidelines/panicdisorder.pdf

Describe the key functions in the body of the biomolecules you studied in this virtual lab AND include key structural details. a. Carbohydrates b. Proteins

CHEM120OX, Week 7 OL Lab

Virtual Lab Week 7: Introduction to Food Macromolecules

Learning Objectives

· Understand the types of macromolecules found in food
· Understand the structure of carbohydrates, proteins, and lipids
· Detect macromolecules in food samples

Introduction

Macromolecules are very large molecules created by the polymerization of small units called monomers. Most of the macromolecules are present in everyday life, for instance in food.

Learn about biological macromolecules

There are several types of biological macromolecules: carbohydrates, proteins, lipids and nucleic acids. All macromolecules, except lipids, are polymers. A polymer is a long molecule composed of chains of monomers. Monomers are small molecules that serve as building blocks of polymers. In addition, there are also oligomers in nature. Oligomers are molecular complexes composed of a few monomer units, instead of the theoretical unlimited number of monomers. Dimers and trimers are oligomers composed of two and three monomers, respectively, such as lactose in milk for instance. However, in biochemistry, an oligomer usually refers to a macromolecular complex formed by non-covalent bonding of a few macromolecules, such as nucleic acids or proteins. An example is the oligomers found in many neurodegenerative diseases, such as the alpha-synuclein aggregations in Parkinson’s disease.

Help your friend with your macromolecule knowledge

In the Introduction to Food Macromolecules simulation, you will help your friend get a healthy diet and investigate the types of macromolecules found in food. By performing a series of biochemistry tests, you will know the contents of various food items.
Can you use your macromolecule knowledge to convince your friend to change her diet to a healthier one?

Study the transcription and translation processes

Begin by learning about the transcription process of DNA to RNA. Discover the translation process where an RNA sequence is read by a ribosome inside a cell and the corresponding to amino acids are made. With these two processes any protein can be made. How do the amino acids form different proteins?

Synthesis of proteins from amino acids

Find out how amino acids are assembled to make proteins. A 3D animation describes how triplets of codons in the RNA sequence are translated into amino acids. Observe how these amino acids are joined together by peptide bonds to create a polypeptide chain: this is the primary structure of a protein. Then watch as the primary structure is folded into secondary, tertiary and quaternary structures. Discover the two main types of secondary structure and see an example of how the tertiary structure of a protein can be modified post-translation.

Part 1: Complete Labster Lab: Introduction to Food Macromolecules

Purpose: Describe in complete sentences and in your own words, the purpose of this experiment.

Observations: Record three observations from the simulation.

Answer the questions below

1. Describe the key functions in the body of the biomolecules you studied in this virtual lab AND include key structural details.
a. Carbohydrates
b. Proteins
c. Lipids
2. Choose a food in your house. What are some of the biomolecules you expect to be in this food and why?

Part 2: Complete Labster Lab: Introduction to Protein Synthesis

3. In your own words, describe the process of gene expression beginning from the nucleus to the formation of the polypeptide sequence.
4. Complete the table below (2 points):

Nucleic acid

Amine Bases Present

Location(s) in cell

DNA

RNA

5. Assume that RNA Polymerase will read the parental strand of DNA given here and write the mRNA sequence that would result: – TATGCTTCCGTA –
Reflection: Consider what you learned from the two simulations. Reflect on three to four key concepts that you learned in this lab exercise. How could the lessons have learned in this virtual lab related to a real world situation in the community/world or your future career? Be specific in your answer (this should require 5-10 sentences).

Grading Rubric: 

Activity 

Deliverable 

Points 

Part I

Complete Week 7 Virtual Lab: Introduction to Macromolecules Simulation

10

Part II  

Complete the Introduction to Protein Synthesis simulation

10

Part III

Complete lab report and answer questions 
· Purpose (1 point) 
· Observation (3 points)  
· Questions (6 points) 
· Reflection (5 points)

15

Total  

Complete all lab activities  

35

1

Identify your selected film, including writer, director, year of release, and genre. Describe the ways in which your chosen film has impacted society or how it has called attention to a particular social issue (i.e., politically or culturally, positive or negative).

You are encouraged to incorporate writing from your Week 2 and Week 3 assignments only after you have reflected on your instructor’s feedback and revised the relevant parts of the essays accordingly. Additionally, refer to the outline template in the Week 4 assignment. As you are incorporating your previous work, be sure to consider the broader requirements and context of this assignment, especially regarding film as a medium of social commentary. Do not simply cut and paste material but rather use it as a building block to construct a new paper addressing this prompt’s requirements.
This final film critique is your opportunity to combine the previously addressed elements from Weeks’ 2 and 3 papers into analyzing one film and how it might influence society or shine a light on a social issue.
Please choose a film from this 

List of Approved Films

 Download List of Approved Films
. Review the 

Week 5 Sample Paper

 Download Week 5 Sample Paper

.

Note: You should watch your chosen film twice—once to ensure that you have grasped the storytelling and once more to specifically analyze scenes, techniques, and elements of the film for your paper. If you would like to write about a film not listed, you must contact your professor to request approval in advance or you may not receive credit for this assignment.

Write: 

In your introductory paragraph,
· Identify your selected film, including writer, director, year of release, and genre..
· Summarize the film in which you apply your knowledge of the difference between the film’s story and its plot.
· Describe one of the broad theories you have learned about in class (auteur theory, genre theory, formalist theory) that you will use to analyze your film in this paper.
· Develop a thesis statement that describes how the specific elements of your chosen film work together to communicate themes relating to a particular social issue.
· Visit the 

Writing a Thesis Statement

Links to an external site.
 resource from the UAGC Writing Center.

In the body of your paper,
· Analyze your selected film using one of the broad theories you have learned about in class (auteur theory, genre theory, formalist theory).
· Evaluate the use of three specific techniques and design elements employed in the film as they contribute to the overarching narrative, theme, and social commentary of your chosen film. This can include elements of mise-en-scène (e.g., lighting, sound, composition of frame, costuming, etc.) and editing (e.g., cuts and transitions, shots used, angles, etc.).
· Describe the ways in which your chosen film has impacted society or how it has called attention to a particular social issue (i.e., politically or culturally, positive or negative).
In the conclusion of your paper,
· Draw connections between each element of your chosen film and how they contribute to the film’s overall stance on a particular social issue, if it is effective in doing so, and why addressing this issue is necessary to society.
 
Final Film Critique: Film and Social Resonance Analysis final paper
· Must be five to six double-spaced pages (1500 to 1800 words) in length (not including title page and references) and formatted according to 

APA Style

Links to an external site.
 as outlined in the Writing Center’s 

APA Formatting for Microsoft WordLinks to an external site.

· Must include a separate title page with the following:
· Title of paper in bold font
· Space should appear between the title and the rest of the information on the title page.
· Student’s name
· Name of institution (The University of Arizona Global Campus)
· Course name and number
· Instructor’s name
· Due date
· Must utilize academic voice. See the 

Academic Voice

Links to an external site.
 resource for additional guidance.

· Must include an introduction and conclusion paragraph. Your introduction paragraph needs to end with a clear thesis statement that indicates the purpose of your paper.
· For assistance on writing 

Introductions & Conclusions

Links to an external site.
 and 

Writing a Thesis Statement

Links to an external site.
, refer to the Writing Center resources.

· Must use at least three scholarly sources in addition to the course text.
· The 

Scholarly, Peer-Reviewed, and Other Credible Sources

Links to an external site.
 table offers additional guidance on appropriate source types. If you have questions about whether a specific source is appropriate for this assignment, please contact your instructor. Your instructor has the final say about the appropriateness of a specific source.

· To assist you in completing the research required for this assignment, view the 

Quick and Easy Library Research

Links to an external site.
 tutorial, which introduces the University of Arizona Global Campus Library and the research process, and provides some library search tips.

· Must document any information used from sources in APA Style as outlined in the Writing Center’s 

APA: Citing Within Your Paper guide.

Links to an external site.

· Must include a separate references page that is formatted according to APA Style as outlined in the Writing Center. See the 

APA: Formatting Your References List

Links to an external site.
 resource in the Writing Center for specifications.

Film I chose is Boyz n the hood