How can health care professionals become aware of these practices in our culture? What are the implications of not telling our health care providers about these practices?
Cultural Competency in Health Care
Discussion Topic- Chapter 3
This week, we read about different practices in different cultures with regards to health care (see tables 3-1, 3-2, 3-3 and 3-4). I invite you this week to tell us about health practices in your culture. If you do not know of any in your culture, feel free to discuss any from the tables provided in our text.
How can health care professionals become aware of these practices in our culture? What are the implications of not telling our health care providers about these practices?
At least 275 words. APA Format
Course Materials: Rose, Patti (2013) Cultural Competency for the Health Professional. Jones and Bartlett
Watch the short video on feminism. Prior to the material covered in the textbook and video what were your views on feminism and how have your views of feminism changed as a result of this new material? Do you think there is still a need for a feminist movement in the United States and around the world? Why or why not?
Sex and Gender
Content
Watch the short video on feminism. Prior to the material covered in the textbook and video what were your views on feminism and how have your views of feminism changed as a result of this new material? Do you think there is still a need for a feminist movement in the United States and around the world? Why or why not? Compose a 2 page paperr reviewing your thoughts on this subject.
@ katiecouric: A Woman’s World?
Duration: (41:04)
YouTube URL: http://www.youtube.com/watch?v=0s2ENRo60Uo
Course Materials: Required Text or E-Book: Wood, Julia T. Gendered Lives. 13th ed. Cengage, 2018-19.ISBN: 978-111134648-5
2 page paperr, APA Format
During the starving time? at Jamestown, from 1609 to 1610, many colonists died from a variety of problems within the colony. The leadership of Jamestown was fractured, Powhatan Indians continued a raiding campaign against the fort, and there was a significant food shortage. What do you think was the most important failure of the Jamestown colonists or leadership that led to the starving time? Do you believe the primary document is an accurate account of the time?
During the “starving time? at Jamestown, from 1609 to 1610, many colonists died from a variety of problems within the colony. The leadership of Jamestown was fractured, Powhatan Indians continued a raiding campaign against the fort, and there was a significant food shortage.
What do you think was the most important failure of the Jamestown colonists or leadership that led to the starving time? Do you believe the primary document is an accurate account of the time? What can we learn from the on-going research at Jamestown and how might this change our understanding of the first sustained English colony in the New World? SEE UPLOADED FILE FOR MORE DETAILS.
Can you find any DNA gene similarities between these organisms? Which ones are the most closely related?2) How many differences are there between the human and chimpanzee sequences? How does the mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)3) Using this information how can DNA be used as evidence for evolution?
The leptin gene makes a protein hormone that is important for regulating body weight and metabolism studies have showed that mice without properly functioning leptin genes become morbidly obese. Below is the DNA sequence of this leptin gene found in three different organisms (Mouse, Chimp, and human); only the first 60 nucleotides of this gene are shown.Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctccaChimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct 1) Can you find any DNA gene similarities between these organisms? Which ones are the most closely related?2) How many differences are there between the human and chimpanzee sequences? How does the mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)3) Using this information how can DNA be used as evidence for evolution?Watch the following video and then answer the questions: (For Closed Captioning, Click on the cc Button)4) What are vestigial structures?5) What are some examples of these structures that we find in humans?6) Can these structure show up again in an organism? Give an example (Hint: Think mutations)7) How do these structure provide evidence for evolution? what the video and answer the following adaptation8) Why did dark-colored rock pocket mice first appear in a population of light-colored rock pocket mice?9) Why do dark-colored rock pocket mice on dark lava flows have white bellies?10) Mutations are always…11) When dark-colored fur gives mice a 1% competitive advantage and 1% of the population begins with dark fur, in about 1,000 years, 95% of the population will have dark fur. Which of the following statements is true?12) What does Dr. Carroll mean when he says while mutation is random, natural selection is not?
What do you think are the two most important practices that should be incorporated into a security awareness policy? 2. Why do you rank them so highly?
Please write a 1-2 page synopsis on the following topic.
Security awareness training is often the first view a typical user has into information security. It?s often required for all new hires. Think of it as the first impression of management?s view of information security. This is management?s opportunity to set the tone. Most individuals want to do a good job, but they need to know what the rules and expected behavior are. That is one of the purposes of a security awareness policy.
Answer the following question(s):
1. What do you think are the two most important practices that should be incorporated into a security awareness policy?
2. Why do you rank them so highly?
List and describe the three different layers of homeland defense.
List and describe the three different layers of homeland defense.
APA-Perdue OwlLinks to an external site.
APA format is required.
Title page, reference page, in text citations (see above link for help.)
References and in text citations must be formatted in APA.
Course reference(s) and one outside reference are required.
Do not copy and paste.
All assignments are scanned by Turn It In Plagiarism checker.
Length of paper should be a minimum of 1-2 written pages. (Title page and reference page are not included in this number.)
Your e-portfolio should have a central theme, such as (Organizational Leadership). Your central theme should be supported by the skills. What will be your central theme (Organizational Leadership)? Why are you selecting this theme? What skills will you select to support the central theme? How do your artifacts and signature assignment support the skills?
Your e-portfolio should have a central theme, such as (Organizational Leadership). Your central theme should be supported by the skills. What will be your central theme (Organizational Leadership)? Why are you selecting this theme? What skills will you select to support the central theme? How do your artifacts and signature assignment support the skills?
*Post must be a minimum of
Explain two activities the family can do at home to support this childs growth and development.
Throughout this course, you have been creating a portfolio that travels with the child you chose. This week, you will focus on preschoolers. For this assignment, you will consider the child you observed in this weeks discussion. Using the template provided, you will complete the Part 3 sections.
Prepare
To prepare for this assignment,
Watch Early Childhood: Using Data to Inform InstructionLinks to an external site..
Watch The Characteristics of Effective Learning: An OverviewLinks to an external site..
Watch Learning through play: A Documentary: 3 to 4 year oldLinks to an external site.
Watch Indoor and Outdoor Learning EnvironmentLinks to an external site..
Watch Early Childhood: Social, Emotional, and Cognitive LearningLinks to an external site..
Read the webpage section More Parenting Tips and ActivitiesLinks to an external site..
Review the courses offered on the PreschoolLinks to an external site. Virtual Lab School webpage.
Find and open your latest version of the Child Portfolio Binder template on your computer. You will be adding on to this document.
Write
Using the Part 3 portion of the template, complete the following on preschoolers:
Complete the anecdotal record from this weeks discussion observation.
Summarize three key take-aways from the observation you conducted this week.
Discuss two developmentally appropriate activities to incorporate in the classroom.
The activities must address at least two different domains.
At least one activity must be play-based.
Describe how you would use one topic from the PreschoolLinks to an external site. Virtual Lab School webpage to further support the needs or strengths of this student.
Describe two elements from a learning environment and how they nurture the physical, socio-emotional, language, or cognitive milestones of this child.
Discuss at least two different domains.
Explain two activities the family can do at home to support this childs growth and development.
The Child Portfolio Part 3 assignment
Must be two pages in length and formatted according to the template.
Must utilize academic voice. See the Academic VoiceLinks to an external site. resource for additional guidance.
Must use at least two scholarly sources in addition to the course text. Cite and reference these sources in APA StyleLinks to an external site. as outlined in the Writing Center.
The Scholarly, Peer-Reviewed, and Other Credible SourcesLinks to an external site. table offers additional guidance on appropriate source types. If you have questions about whether a specific source is appropriate for this assignment, please contact your instructor. Your instructor has the final say about the appropriateness of a specific source.
To assist you in completing the research required for this assignment, view the Quick and Easy Library ResearchLinks to an external site. tutorial, which introduces the UAGC Library and the research process, and provides some library search tips.
Discuss how technology and informatics are utilized to support the interventions of Advanced Practice Nurses? Discuss how employing evidence-based practice guidelines improve patient outcomes? What benefits and challenges have you experienced with the integration of information technology in your practice?
TOPIC: Technical Support to Healthcare: Electronic Health Records and Applications
Choose a specific evidence-based practice (examples: CLABSI prevention, Sepsis risk assessment, Vaccination schedules, etc.).
Discuss how technology and informatics are utilized to support the interventions of Advanced Practice Nurses?
Discuss how employing evidence-based practice guidelines improve patient outcomes?
What benefits and challenges have you experienced with the integration of information technology in your practice?
What strategies did you, or could you, use to overcome these challenges?
If you could design the ?perfect? EHR to enhance and support evidence-based practice, what would you include? How would this new technology improve patient care?
Use 4-5 resources/reference within the last 5 years ONLY.
Discuss health promotion, illness prevention, health maintenance, health restoration, and rehabilitation in relation to the nurse’s role in working with various populations.
Disussion | Nursing homework help
Echems3
Discuss the professional nurse’s role in health-promotion activities.
Examine theories and concepts related to health-promotion behaviors.
Discuss health promotion, illness prevention, health maintenance, health restoration, and rehabilitation in relation to the nurse’s role in working with various populations.
