As aspiring health care managers, it is important to stay on top of the technological advances available to help keep your organization running effectively. Telemedicine, neural engineering, and health care robotics are transforming health care today while providing patient care and improving the health care delivery system as a whole. Complete the Technology Evaluation Chart. Identify the selected trends in health care technology and consider how an organization integrates the selected technology into existing systems.
Assignment Content
As aspiring health care managers, it is important to stay on top of the technological advances available to help keep your organization running effectively. Telemedicine, neural engineering, and health care robotics are transforming health care today while providing patient care and improving the health care delivery system as a whole.
Complete the Technology Evaluation Chart. Identify the selected trends in health care technology and consider how an organization integrates the selected technology into existing systems.
Go to the Centers for Disease Control and Prevention website and review at least three to five topics listed in the Health, United StatesLinks to an external site. section. Examine the At-a-glance Table and the United States Data Finder tables to review the costs of health care in the United States. Determine the most commonly used population and individual measures used in providing health care today. Examine the primary impact that these measures exert on the choices that consumers make in order to address their own health care needs. Justify your response.
Go to the Centers for Disease Control and Prevention website and review at least three to five topics listed in the Health, United StatesLinks to an external site. section. Examine the At-a-glance Table and the United States Data Finder tables to review the costs of health care in the United States. Determine the most commonly used population and individual measures used in providing health care today. Examine the primary impact that these measures exert on the choices that consumers make in order to address their own health care needs. Justify your response.
Respond to at least two of your colleagues? posts (on different days) in one or more of the following ways: Compare your academic goals and vision for positive social change with those of your colleague. Offer a suggestion to help your colleague realize their academic goals and vision for positive social change.
Respond to at least two of your colleagues? posts (on different days) in one or more of the following ways:
Compare your academic goals and vision for positive social change with those of your colleague.
Offer a suggestion to help your colleague realize their academic goals and vision for positive social change.
Although there is no specific word count required for responses to colleagues, a good follow-up response can typically be expressed in 100?200 words. Responses should enrich the initial post by supporting and/or adding a fresh viewpoint and be constructive, enhancing the learning for all students.
What are the five hierarchies of human needs that motivate our behavior? Provide concrete examples of each. How can you use Maslow’s hierarchy to promote your student’s wellbeing in the classroom? Reflect and provide unique examples.
Based on the videos below, please reflect and answer the following question. (Be sure to exhibit careful thought and logical reasoning in your reflection response.)
What are the five hierarchies of human needs that motivate our behavior? Provide concrete examples of each.
How can you use Maslow’s hierarchy to promote your student’s wellbeing in the classroom? Reflect and provide unique examples.
How can educators motivate students that are struggling and falling behind? Reflect and provide concrete examples.
Analyze and explain the main dimensions of the attribution theory of motivation.
Discuss the concepts that were most challenging for you in the readings and review material. How did the practice exercises help clarify these?
1. Discuss the concepts that were most challenging for you in the readings and review material. How did the practice exercises help clarify these?
I think the practice exercises really helped me understand the difference between corporate finance and managerial accounting. Each lesson focused on a different perspective. Until now, we looked at projects from a manager’s point of view, dealing with money and measuring results. But now, we’re shifting our focus to banking, CFOs, and investment funds.
Also, I knew Excel had functions to help with calculations, but the ones in the practice guide were a bit tricky. The practice exercise enabled me to use the excel functions and gave me some difficulty was 6.42. I was stuck for a bit, so I had to turn to good old YouTube for more help.
2. What did you learn that will help you determine which assets to invest in and where to disinvest to help LGI improve its operations, generate cash flow, and improve the bottom line?
I think the most important thing for helping LGI is knowing the present value of its assets. The present value is like the current worth of money we’ll get in the future, considering a certain interest rate. If a manager understands this, they know that money received in the future isn’t as valuable as the same amount received today.
And, if you don’t spend money now, it won’t be worth as much in the future because of things like inflation or the return on investments. Not investing has a cost, called opportunity cost.
Understanding these types of concepts can help managers make decisions that make the company more profitable and bring in more cash.
References
Davis, C. E. & Davis, E. (2011a). Chapter 5: The Time Value of Money. https://learning.oreilly.com/library/view/fundamentals-of-corporate/9780470876442/16_chapter05.html#ch5-sec001
Gallo, A. (2014) A Refresher on Net Present Value. Harvard Business review. Retrieved from https://hbr.org/2014/11/a-refresher-on-net-present-value
BRIANS POST:
1. Discuss the concepts that were most challenging for you in the readings and review material. How did the practice exercises help clarify these?
I enjoyed reading about the time value of money and the future value of money. The course reading in Chapter 5 brings to light some minor things that I wouldnt have previously considered that would have ultimately negatively impacted my calculations. I think these two concepts set me up for success for the rest of the reading. However, multiple cash flows and all the different aspects of annuities and perpetuities proved to be a bit more difficult for me. I may just be thinking of these concepts as difficult due to all the calculations that involved in the which could cause an error if a number is off. But, as the book mentions multiple times, I will do my best to ensure correctness at each step due to the lack of a financial calculator, though I intend to use a spreadsheet, to ensure the overall result is correct (Davis & Davis, 2011a). These topics arent exactly difficult, just strenuous and a bit time consuming to ensure correctness.
The information in the practice guide was helpful to reinforce the information provided in the book. I appreciate the extra examples given as well as the detail in all of the formulas used. Problem 6.42 was especially helpful in enhancing my understanding of the concepts described above that caused me some trouble.
1. What did you learn that will help you determine which assets to invest in and where to disinvest to help LGI improve its operations, generate cash flow, and improve the bottom line?
Some of the concepts that I think will assist me with Project 4 are time value of money, future value, and compounding interest. All of these concepts will aid me in determining which assets to advise LGI to invest or disinvest in. Understanding the concept of time value of money will help me analyze which assets would give LGI the most financial flexibility in the future and help to align its financials with its goals (Davis & Davis, 2011a). The concept of future value will help me to build upon that analysis and provide close estimates on returns, future values, etc. Lastly, the concept of compounding interest will further build on the previous two concepts to provide LGI with an outlook of how its money will grow with certain investments over different periods of time.
References:
Davis, C. E. & Davis, E. (2011a). Chapter 5: The Time Value of Money. https://learning.oreilly.com/library/view/fundamentals-of-corporate/9780470876442/16_chapter05.html#ch5-sec001
Davis, C. E. & Davis, E. (2011b). Chapter 6: Discounted Cash Flows and Valuation. https://learning.oreilly.com/library/view/fundamentals-of-corporate/9780470876442/17_chapter06.html#ch6-sec001
How can health care professionals become aware of these practices in our culture? What are the implications of not telling our health care providers about these practices?
Cultural Competency in Health Care
Discussion Topic- Chapter 3
This week, we read about different practices in different cultures with regards to health care (see tables 3-1, 3-2, 3-3 and 3-4). I invite you this week to tell us about health practices in your culture. If you do not know of any in your culture, feel free to discuss any from the tables provided in our text.
How can health care professionals become aware of these practices in our culture? What are the implications of not telling our health care providers about these practices?
At least 275 words. APA Format
Course Materials: Rose, Patti (2013) Cultural Competency for the Health Professional. Jones and Bartlett
Watch the short video on feminism. Prior to the material covered in the textbook and video what were your views on feminism and how have your views of feminism changed as a result of this new material? Do you think there is still a need for a feminist movement in the United States and around the world? Why or why not?
Sex and Gender
Content
Watch the short video on feminism. Prior to the material covered in the textbook and video what were your views on feminism and how have your views of feminism changed as a result of this new material? Do you think there is still a need for a feminist movement in the United States and around the world? Why or why not? Compose a 2 page paperr reviewing your thoughts on this subject.
@ katiecouric: A Woman’s World?
Duration: (41:04)
YouTube URL: http://www.youtube.com/watch?v=0s2ENRo60Uo
Course Materials: Required Text or E-Book: Wood, Julia T. Gendered Lives. 13th ed. Cengage, 2018-19.ISBN: 978-111134648-5
2 page paperr, APA Format
During the starving time? at Jamestown, from 1609 to 1610, many colonists died from a variety of problems within the colony. The leadership of Jamestown was fractured, Powhatan Indians continued a raiding campaign against the fort, and there was a significant food shortage. What do you think was the most important failure of the Jamestown colonists or leadership that led to the starving time? Do you believe the primary document is an accurate account of the time?
During the “starving time? at Jamestown, from 1609 to 1610, many colonists died from a variety of problems within the colony. The leadership of Jamestown was fractured, Powhatan Indians continued a raiding campaign against the fort, and there was a significant food shortage.
What do you think was the most important failure of the Jamestown colonists or leadership that led to the starving time? Do you believe the primary document is an accurate account of the time? What can we learn from the on-going research at Jamestown and how might this change our understanding of the first sustained English colony in the New World? SEE UPLOADED FILE FOR MORE DETAILS.
Can you find any DNA gene similarities between these organisms? Which ones are the most closely related?2) How many differences are there between the human and chimpanzee sequences? How does the mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)3) Using this information how can DNA be used as evidence for evolution?
The leptin gene makes a protein hormone that is important for regulating body weight and metabolism studies have showed that mice without properly functioning leptin genes become morbidly obese. Below is the DNA sequence of this leptin gene found in three different organisms (Mouse, Chimp, and human); only the first 60 nucleotides of this gene are shown.Mouse: gaggga tcc ctgctccagc agctgcaagg taaggcccggggcgcgctact ttctcctccaChimp: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct Human: gtaggaatcg cagcgccagc ggttgcaagg taaggccccg gcgcgctcct tcctccttct 1) Can you find any DNA gene similarities between these organisms? Which ones are the most closely related?2) How many differences are there between the human and chimpanzee sequences? How does the mouse sequence compare to the human sequence? (Hint: Count the DNA nucleotides)3) Using this information how can DNA be used as evidence for evolution?Watch the following video and then answer the questions: (For Closed Captioning, Click on the cc Button)4) What are vestigial structures?5) What are some examples of these structures that we find in humans?6) Can these structure show up again in an organism? Give an example (Hint: Think mutations)7) How do these structure provide evidence for evolution? what the video and answer the following adaptation8) Why did dark-colored rock pocket mice first appear in a population of light-colored rock pocket mice?9) Why do dark-colored rock pocket mice on dark lava flows have white bellies?10) Mutations are always…11) When dark-colored fur gives mice a 1% competitive advantage and 1% of the population begins with dark fur, in about 1,000 years, 95% of the population will have dark fur. Which of the following statements is true?12) What does Dr. Carroll mean when he says while mutation is random, natural selection is not?
What do you think are the two most important practices that should be incorporated into a security awareness policy? 2. Why do you rank them so highly?
Please write a 1-2 page synopsis on the following topic.
Security awareness training is often the first view a typical user has into information security. It?s often required for all new hires. Think of it as the first impression of management?s view of information security. This is management?s opportunity to set the tone. Most individuals want to do a good job, but they need to know what the rules and expected behavior are. That is one of the purposes of a security awareness policy.
Answer the following question(s):
1. What do you think are the two most important practices that should be incorporated into a security awareness policy?
2. Why do you rank them so highly?