Thousands of simultaneous chemical reactions occur in the body that involve transfer of electrons from one substance to another. These reactions are either oxidation or reduction. Explain both.#2 The story of how the body maintains its continuous energy supply begins with Adenosine Triphosphate (ATP). Discuss how energy is trapped in ATP, how ATP is broken down, and how it immediately reforms itself.
#1 Thousands of simultaneous chemical reactions occur in the body that involve transfer of electrons from one substance to another. These reactions are either oxidation or reduction. Explain both.#2 The story of how the body maintains its continuous energy supply begins with Adenosine Triphosphate (ATP). Discuss how energy is trapped in ATP, how ATP is broken down, and how it immediately reforms itself.#3 The Krebs Cycle is named for Nobel Prize winner (1953) Hans Krebs. Discuss this process. #4 Discuss how exercise intensity and duration determines macronutrient use.#5 Direct and indirect calorimetry are two different measures that accurately quantify the energy generated by the body during rest and physical activity. Compare and contrast these and discuss how each is measured.#6 The respiratory quotient (RQ) feres to the ratio of metabolic gas exchange. Discuss the RQ of carbs, fats, and proteins.#7 Discuss the three components of daily energy expenditure.
Discuss why obesity is a global epidemic. How do you plan to decrease obesity behaviors in your family/job? List and discuss the principles of good eating.
#1 Discuss why obesity is a global epidemic. How do you plan to decrease obesity behaviors in your family/job?#2 List and discuss the principles of good eating. Everyone uses a different principle.
Explain how a health care organization uses nursing-sensitive quality indicators to enhance patient safety, patient care outcomes, and organizational performance reports.
Preparation- As you begin to prepare this assessment you are encouraged to complete the Conabedian Quality Assessment Framework activity. Quality health care delivery requires systematic action. Completion of this will help you succeed with the assessment as you consider how the triad of structure (such as the hospital, clinic, provider qualifications/organizational characteristics) and process (such as the delivery/coordination/education/protocols/practice style or standard of care) may be modified to achieve quality outcomes.
This assessment requires you to prepare an 810 minute audio training tutorial (with optional video) for new nurses on the importance of nursing-sensitive quality indicators. To successfully prepare for your assessment, you will need to complete the following preparatory activities:
· Select a single nursing-sensitive quality indicator that you see as important to a selected type of health care system. Choose from the following list:
·
Staffing measures.
· Nursing hours per patient day.
· RN education/certification.
· Skill mix.
· Nurse turnover.
· Nursing care hours in emergency departments, perioperative units, and perinatal units.
·
·
· Skill mix in emergency departments, perioperative units, and perinatal units.
·
Quality measures.
· Patient falls.
· Patient falls with injury.
· Pressure ulcer prevalence.
· Health care-associated infections.
· Catheter-associated urinary tract infection.
· Central line catheter associated blood stream infection.
· Ventilator-associated pneumonia.
· Ventilator- associated events.
· Psychiatric physical/sexual assault rate.
· Restraint prevalence.
· Pediatric peripheral intravenous infiltration rate.
· Pediatric pain assessment, intervention, reassessment (air) cycle.
· Falls in ambulatory settings.
· Pressure ulcer incidence rates from electronic health records.
· Hospital readmission rate
· RN satisfaction survey options.
· Job satisfaction scales.
· Job satisfaction scales short form.
· Practice environment scale.
· Conduct independent research on the most current information about the selected nursing-sensitive quality indicator.
· Interview a professional colleague or contact who is familiar with quality monitoring and how technology can help to collect and report quality indicator data.
You do not need to submit the transcript of your conversation, but do integrate what you learned from the interview into the audio tutorial. Consider these questions for your interview:
· What is your experience with collecting data and entering it into a database?
· What challenges have you experienced?
· How does your organization share with the nursing staff and other members of the health care system the quality improvement monitoring results?
· What role do bedside nurses and other frontline staff have in entering the data? For example, do staff members enter the information into an electronic medical record for extraction? Or do they enter it into another system? How effective is this process?
· Watch the
Informatics and Nursing-Sensitive Quality Indicators Video Exemplar
.
Recording Your Presentation
To prepare to record the audio for your presentation, complete the following:
· Set up and test your microphone or headset using the installation instructions provided by the manufacturer. You only need to use the headset if your audio is not clear and high quality when captured by the microphone.
· Practice using the equipment to ensure the audio quality is sufficient.
· Review
Using Kaltura
for Kaltura to record your presentation.
· View
Creating a Presentation: A Guide to Writing and Speaking
. This video addresses the primary areas involved in creating effective audiovisual presentations. You can return to this resource throughout the process of creating your presentation to view the tutorial appropriate for you at each stage.
Notes:
· You may use other tools to record your tutorial. You will, however, need to consult
Using Kaltura
for instructions on how to upload your audio-recorded tutorial into the courseroom, or you must provide a working link your instructor can easily access.
· You may also choose to create a video of your tutorial, but this is not required.
· If you require the use of assistive technology or alternative communication methods to participate in this activity, please contact
[email protected]
to request accommodations.
Instructions- For this assessment, imagine you are a member of a Quality Improvement Council at any type of health care system, whether acute, ambulatory, home health, managed care, et cetera. Your Council has identified that newly hired nurses would benefit from comprehensive training on the importance of nursing-sensitive quality indicators. The Council would like the training to address how this information is collected and disseminated across the organization. It would also like the training to describe the role nurses have in accurate reporting and high-quality results.
The Council indicates a recording is preferable to a written fact sheet due to the popularity of audio blogs. In this way, new hires can listen to the tutorial on their own time using their phone or other device.
As a result of this need, you offer to create an audio tutorial orienting new hires to these topics. You know that you will need a script to guide your audio recording. You also plan to incorporate into your script the insights you learned from conducting an interview with an authority on quality monitoring and the use of technology to collect and report quality indicator data.
You determine that you will cover the following topics in your audio tutorial script:
Introduction: Nursing-Sensitive Quality Indicator
· What is the National Database of Nursing-Sensitive Quality Indicators?
· What are nursing-sensitive quality indicators?
· Which particular quality indicator did you select to address in your tutorial?
· Why is this quality indicator important to monitor?
· Be sure to address the impact of this indicator on the quality of care and patient safety.
· Why do new nurses need to be familiar with this particular quality indicator when providing patient care?
Collection and Distribution of Quality Indicator Data
· According to your interview and other resources, how does your organization collect data on this quality indicator?
· How does the organization disseminate aggregate data?
· What role do nurses play in supporting accurate reporting and high-quality results?
· As an example, consider the importance of accurately entering data regarding nursing interventions.
After completing your script, practice delivering your tutorial several times before recording it.
·
Additional Requirements-Audio communication: Deliver a professional, effective audio tutorial on a selected quality indicator that engages new nurses and motivates them to accurately report quality data in a timely fashion.
·
Length: 810 minute audio recording. Use Kaltura to upload your recording to the courseroom, or provide a working link your instructor can access.
·
Script: A separate document with the script or speaker’s notes is required.
Important: Submissions that do not include the script or speaker’s notes will be returned as a non-performance.
·
References: Cite a minimum of three scholarly and/or authoritative sources.
·
APA: Submit, along with the recording, a separate reference page that follows APA style and formatting guidelines. For an APA refresher, consult the
Evidence and APA
page on Campus.
Context-The American Nursing Association (ANA) established the National Database of Nursing Quality Indicators (NDNQI®) in 1998 to track and report on quality indicators heavily influenced by nursing action.
NDNQI® was established as a standardized approach to evaluating nursing performance in relation to patient outcomes. It provides a database and quality measurement program to track clinical performance and to compare nursing quality measures against other hospital data at the national, regional, and state levels. Nursing-sensitive quality indicators help establish evidence-based practice guidelines in the inpatient and outpatient settings to enhance quality care outcomes and initiate quality improvement educational programs, outreach, and protocol development.
The quality indicators the NDNQI® monitors are organized into three categories: structure, process, and outcome. Theorist Avedis Donabedian first identified these categories. Donabedians theory of quality health care focused on the links between quality outcomes and the structures and processes of care (Grove et al., 2018).
Nurses must be knowledgeable about the indicators their workplaces monitor. Some nurses deliver direct patient care that leads to a monitored outcome. Other nurses may be involved in data collection and analysis. In addition, monitoring organizations, including managed care entities, exist to gather data from individual organizations to analyze overall industry quality. All of these roles are important to advance quality and safety outcomes.
Reference
Grove, S. K., Gray, J. R., Jay, G. W., Jay, H. M., & Burns, N. (2018).
Understanding nursing research: Building an evidence-based practice (7th ed.). Elsevier.
Competencies Measured-By successfully completing this assessment, you will demonstrate your proficiency in the following course competencies and scoring guide criteria:
· Competency 1: Describe nurses’ and the interdisciplinary team’s role in informatics with a focus on electronic health information and patient care technology to support decision making.
· Describe the interdisciplinary teams role in collecting and reporting quality indicator data to enhance patient safety, patient care outcomes, and organizational performance reports.
· Competency 3: Evaluate the impact of patient care technologies on desired outcomes.
· Explain how a health care organization uses nursing-sensitive quality indicators to enhance patient safety, patient care outcomes, and organizational performance reports.
· Competency 4: Recommend the use of a technology to enhance quality and safety standards for patients.
· Justify how a nursing-sensitive quality indicator establishes evidence-based practice guidelines for nurses to follow when using patient care technologies to enhance patient safety, satisfaction, and outcomes.
· Competency 5: Apply professional, scholarly communication to facilitate use of health information and patient care technologies.
· Deliver a professional, effective audio tutorial on a selected quality indicator that engages new nurses and motivates them to accurately report quality data in a timely fashion.
· Follow APA style and formatting guidelines for citations and references.
Scoring Guide
Use the scoring guide to understand how your assessment will be evaluated.
CRITERIA
NON-PERFORMANCE
BASIC
PROFICIENT
DISTINGUISHED
Describe the interdisciplinary teams role in collecting and reporting quality indicator data to enhance patient safety, patient care outcomes, and organizational performance reports.
Explain how a health care organization uses nursing-sensitive quality indicators to enhance patient safety, patient care outcomes, and organizational performance reports.
Justify how a nursing-sensitive quality indicator establishes evidence-based practice guidelines for nurses to follow when using patient care technologies to enhance patient safety, satisfaction, and outcomes.
Deliver a professional, effective audio tutorial on a selected quality indicator that engages new nurses and motivates them to accurately report quality data in a timely fashion.
·
Identify motivational processes and other factors specific to how this MNC operates in a cross-cultural environment that would factor into your decision-making process of wanting to work there.
Course Syllabus
Course Description
Presents a study of the challenges that confront managers of organizations and individuals in global settings. Special focus
is placed on benefits of diversity derived from interactions between different cultures. The course also covers an overview of
markets, governments, and organizations as well as a general overview of the concepts of internationalization in
contemporary business.
Course Textbook(s)
Luthans, F., & Doh, J. P. (2021). International management: Culture, strategy, and behavior (11th ed.). McGraw-Hill
Education. https://online.vitalsource.com/#/books/9781260563979
Course Learning Outcomes
Upon completion of this course, students should be able to:
1. Categorize consequences of globalization on countries around the world.
2. Compare and contrast the impact of different political, legal, and economic systems on international management.
3. Defend ethics and social responsibility in international management.
4. Evaluate the cultural challenges of managing an international business.
5. Analyze important elements of effective cross-cultural negotiation and communication.
6. Examine international management strategies that emphasize global integration versus local adaptation.
7. Compare and contrast the entry methods and approaches tailored to international business organizations.
8. Assess political risks of international organizations managing their relationships with national governments.
Academic Integrity
Honesty and integrity are taken very seriously at Waldorf University. All students should be familiar with the Waldorf
University Academic Integrity Policy (found in the current Student Handbook) and the consequences that will result from
breaches of this policy.
Credits
Upon completion of this course, the students will earn 3.00 hours of college credit.
Course Structure
BUS 4426, International
Management
BUS 4426, International Management 1
1. Study Guide: Course units contain a Study Guide that provides students with the learning outcomes, unit lesson,
required unit resources, assignments, and supplemental resources.
2. Learning Outcomes: Each unit contains Learning Outcomes that specify the measurable skills and knowledge
students should gain upon completion of the unit.
3. Unit Lesson: Unit Lessons, which are located in the Study Guide, discuss lesson material.
4. Required Unit Resources: Units contain Required Unit Resources from one or more chapters from the textbook
and/or outside resources.
5. Suggested Unit Resources: Suggested Unit Resources are listed within the Study Guide. Students are encouraged
to read the resources listed if the opportunity arises, but they will not be tested on their knowledge of the Suggested
Unit Resources.
6. Learning Activities (Nongraded): Nongraded Learning Activities are provided to aid students in their course of
study.
7. Discussion Boards: Students are required to submit Discussion Board posts in Units I-VIII. Discussion Boards
provide students the opportunity for student-to-student and professor-to-student interaction based on relevant course
concepts and ideas. Specific information about accessing the Discussion Board rubric is provided below.
8. Unit Quizzes: This course contains Unit Quizzes. It is suggested that the quizzes be completed before students
complete the Unit Assessments. Quizzes are used to give students quick feedback on their understanding of the unit
material.
9. Unit Assessments: This course contains Unit Assessments, which test student knowledge on important aspects of
the course. These tests may come in many different forms, ranging from multiple choice to written response
questions.
10. Unit Assignments: Students are required to submit for grading Unit Assignments. Specific information and
instructions regarding these assignments are provided below. Grading rubrics are included with each assignment.
Specific information about accessing these rubrics is provided below.
11. Ask the Professor: This communication forum provides students with an opportunity to ask their professor general
questions or questions related to course content.
12. Student Break Room: This communication forum allows for casual conversation with other classmates.
Unit Assignments
Unit III PowerPoint Presentation
The functions of management are essentially the same everywhere, but the functions are often performed differently in
different countries as a result of culture.
In this assignment you will develop a PowerPoint presentation that explores how the nine Global Leadership and
Organizational Behavior Effectiveness (GLOBE) cultural dimensions can affect many aspects of management functions or
responsibilitiesplanning, communication, decision-making, risk management, ethics, social responsibility, human
resource managementin an international business environment.
Your PowerPoint presentation must accomplish the following:
Address all nine GLOBE cultural dimensions.
For each dimension, you must correlate at least one management aspect that can be impacted by it. You must correlate
each of the seven aspects listed above, and then use two additional aspects of your choice. You may choose any
management aspect that applies to international business; however, you may only use each aspect once. Each
dimension should be correlated to a distinct aspect.
For each aspect/dimension correlation, offer a real-world example to illustrate the impact. Explain how the cultural
dimension applies in each of your examples. Examples may also only be used once, resulting in each correlation having
a unique example.
Use the Speaker Notes feature in PowerPoint for each content slide to elaborate on the slide content. Each slide must
have at least 50 words of Speaker Notes.
Use at least two sources to support your presentation, one of which may be your textbook.
Be creative in choosing your examples. You are encouraged to present examples from a wide variety of cultures or
regions. For instance, try not to limit your examples to all Latin American countries or cultures. Choose examples that
demonstrate your understanding of how the dimensions are applied globally.
Your PowerPoint presentation must be at least 10 slides, not counting the title or reference slide. You must use at least
three sources to support your presentation, one of which must come from the Waldorf Online Library. All sources used
must have APA Style citations and references. APA formatting is otherwise not required.
BUS 4426, International Management 2
Unit VII Case Study
For this assignment, you will apply your knowledge of course concepts in writing a case study focusing on a top performing
chief executive officer (CEO) of a multinational corporation (MNC) and the leadership and management issues they face
doing business on a global scale in the 21st century.
Begin by researching the rankings of top performing CEOs of MNCs. Suggestions include the following:
Phebe Novakovic (General Dynamics)
Tim Cook (Apple)
Susan Wojciki (YouTube)
Sundar Pichal (Google)
Elon Musk (Tesla/SpaceX)
Albert Bourla (Pfizer)
Mary Barra (General Motors)
Choose one CEO (they may be from this list or your own selection). Begin your paper with an introduction summarizing
their background and career. Write a case study that accomplishes the following:
Describe the company, its product(s), and its target market.
Summarize the companys global presence. Where do they physically operate? Where do they sell their product or
service?
Identify and summarize the CEOs leadership style. Discuss positive and negative characteristics/traits of the CEO.
What makes them effective as a global leader of an MNC?
What makes this CEO effective at cross-cultural communication and negotiation?
Discuss how the CEO promotes ethics and social responsibility through their leadership and strategies.
Characterize the organizational culture of the company and how this affects the CEOs management across cultures.
Using specific examples from at least two different cultures, explain how culture affects the CEOs decision-making and
leadership actions.
Explore the challenges the CEO has faced in global operations.
Assess potential challenges this company and CEO may face in the future doing business on a global scale.
Your case study should demonstrate an insightful and thorough analysis with strong arguments and evidence. Your case
study must be at least five but no more than seven pages, not counting the title and reference pages. You must use at least
five academic or industry reliable sources to support your case study. One of these sources must come from the Waldorf
Online Library. All sources used must have citations and references in APA Style. APA formatting is otherwise not required.
Unit VIII Essay
The purpose of this assignment is for you to analyze multinational corporations (MNCs) to make employment decisions (i.e.,
do you really want to work for this organization or corporation based on the information you discover?) and to assess the
human resource practices used in international business. This assignment will allow you to apply concepts learned in this
unit and enhance your research, analysis, and decision-making skills as an international manager.
First select a global industry that interests you. If you do not have a favorite yet, consider an industry (e.g., communications,
banking, broadcasting, entertainment, administration) that you aspire to work in. Once you have selected a global industry,
use your preferred internet search engine to select and research an MNC on which to base this assignment. You may not
choose an MNC for which you currently or have previously worked.
Once you have selected an MNC for which you aspire to work, write an essay based on your research that evaluates the
MNC and characterizes why you would want to work there. Your essay must accomplish the following:
Begin with an introduction that gives a brief overview of the MNC to include its industry, product or services, operating
locations, and mission.
Analyze the political, legal/regulatory, and technological factors that affect the MNCs human resource management
efforts.
Identify sources that are used to fill organizational management positions.
Examine an international job listing for this MNC in which you might be interested. Evaluate the selection criteria, and
discuss how the selection criteria and processes are impacted by culture and the global business environment.
What culture-specific training or professional development is offered or would be needed for you to be successful in the
selected overseas position in this MNC?
Identify motivational processes and other factors specific to how this MNC operates in a cross-cultural environment that
would factor into your decision-making process of wanting to work there.
Finally, conclude your essay with a summary of how your values, cultural competence, ethics, and understanding of
BUS 4426, International Management 3
international business best practices aligns with or differs from those of the MNC. Would you choose to work here based
on what you have learned in this course about international management?
Your essay must be at least three pages, not counting the title and reference pages. You must use at least three sources to
support your essay, one of which may be your textbook. All sources used must have citations and references in APA Style.
APA formatting is otherwise not necessary.
Submitting Course Papers/Projects
Once you have completed your papers/projects, submit your completed papers/projects by uploading through the
Assignment tab in each unit. Do not e-mail your paper directly to your professor. By using the Assignment tab, your record
will automatically be updated to indicate you have submitted your papers/projects, and the assignment will be provided to
your professor for grading. Instructions for submitting your assignment can be found under the Assignment tab in each unit.
APA Guidelines
Waldorf University requires that students use the APA style for papers and projects. Therefore, the APA rules for formatting,
quoting, paraphrasing, citing, and listing of sources are to be followed. Information about using APA style can be found in
APA Style Help in the Course Menu. This area provides links to Internet sites, tutorials, and guides that provide
comprehensive information on APA formatting, including examples and sample papers.
Grading Rubrics
This course utilizes analytic grading rubrics as tools for your professor in assigning grades for all learning activities. Each
rubric serves as a guide that communicates the expectations of the learning activity and describes the criteria for each level
of achievement. In addition, a rubric is a reference tool that lists evaluation criteria and can help you organize your efforts to
meet the requirements of that learning activity. It is imperative for you to familiarize yourself with these rubrics because
these are the primary tools your professor uses for assessing learning activities.
Rubric categories include (1) Discussion Board, (2) Assessment (Written Response), and (3) Assignment. However, it is
possible that not all of the listed rubric types will be used in a single course (e.g., some courses may not have
Assessments).
The Discussion Board rubric can be found within Unit Is Discussion Board submission instructions.
The Assessment (Written Response) rubric can be found embedded in a link within the directions for each Unit
Assessment. However, these rubrics will only be used when written-response questions appear within the Assessment.
Each Assignment type (e.g., article critique, case study, research paper) will have its own rubric. The Assignment rubrics
are built into Blackboard, allowing students to review them prior to beginning the Assignment and again once the
Assignment has been scored. This rubric can be accessed via the Assignment link located within the unit where it is to be
submitted. Students may also access the rubric through the course menu by selecting the Grades link.
Again, it is vitally important for you to become familiar with these rubrics because their application to your
Discussion Boards, Assessments, and Assignments is the method by which your instructor assigns all grades.
Communication Forums
These are non-graded discussion forums that allow you to communicate with your professor and other students.
Participation in these discussion forums is encouraged, but not required. You can access these forums with the buttons in
the Course Menu. Instructions for subscribing/unsubscribing to these forums are provided below.
Click here for instructions on how to subscribe/unsubscribe and post to the Communication Forums.
Ask the Professor
BUS 4426, International Management 4
This communication forum provides you with an opportunity to ask your professor general or course content questions.
Questions may focus on Blackboard locations of online course components, textbook or course content elaboration,
additional guidance on assessment requirements, or general advice from other students.
Questions that are specific in nature, such as inquiries regarding assessment/assignment grades or personal
accommodation requests, are NOT to be posted on this forum. If you have questions, comments, or concerns of a non-
public nature, please feel free to email your professor. Responses to your post will be addressed or emailed by the
professor within 48 hours.
Before posting, please ensure that you have read all relevant course documentation, including the syllabus,
assessment/assignment instructions, faculty feedback, and other important information.
Student Break Room
This communication forum allows for casual conversation with your classmates. Communication on this forum should
always maintain a standard of appropriateness and respect for your fellow classmates. This forum should NOT be used to
share assessment answers.
Schedule/Grading
The following pages contain a printable Course Schedule to assist you through this course. By following this schedule, you
will be assured that you will complete the course within the time allotted.
Unit I Globalization, Ethics, and Social Responsibility [ Weight: 12% ]
Read/View: Unit I Study Guide
Chapter 1: Globalization and International Linkages
Chapter 3: Ethics, Social Responsibility, and Sustainability, pp. 76100
Brief Integrative Case 1.1: “Advertising or Free Speech? The Case of Nike and Human
Rights,” pp. 101103
Discuss: Unit I Discussion Board 2%
Submit: Unit I Assessment 10%
Unit II Politics, Legalities, Technologies, Risks, and Relationships [ Weight: 12% ]
Read/View: Unit II Study Guide
Chapter 2: The Political, Legal, and Technological Environment
Chapter 10: Managing Political Risk, Government Relations, and Alliances
Discuss: Unit II Discussion Board 2%
Submit: Unit II Assessment 10%
Unit III Management in a Cross-Cultural Environment [ Weight: 12% ]
Read/View: Unit III Study Guide
Chapter 4: The Meanings and Dimensions of Culture
Chapter 5: Managing Across Cultures
Discuss: Unit III Discussion Board 2%
Submit: Unit III Quiz
Unit III PowerPoint Presentation
2%
8%
BUS 4426, International Management 5
Unit IV Organizational Culture, Diversity, and Cross-Cultural Communications [ Weight: 12% ]
Read/View: Unit IV Study Guide
Chapter 6: Organizational Cultures and Diversity
Chapter 7: Cross-Cultural Communication and Negotiation
In-Depth Integrative Case 2.1a: “Euro Disneyland,” pp. 257266
Discuss: Unit IV Discussion Board 2%
Submit: Unit IV Assessment 10%
Unit V Strategy Formulation and Organizational Structure [ Weight: 12% ]
Read/View: Unit V Study Guide
Chapter 8: Strategy Formulation and Implementation
Chapter 9: Entry Strategies and Organizational Structures
Discuss: Unit V Discussion Board 2%
Submit: Unit V Assessment 10%
Unit VI Management Decisions and Leadership Across Cultures [ Weight: 12% ]
Read/View: Unit VI Study Guide
Chapter 11: Management Decision and Control
Chapter 13: Leadership Across Cultures
Brief Integrative Case 3.1: “Google in China: Protecting Property and Rights,” pp. 407411
Discuss: Unit VI Discussion Board 2%
Submit: Unit VI Assessment 10%
Unit VII Leadership and Management in Global Business [ Weight: 15% ]
Read/View: Unit VII Study Guide
Unit Resources (3 articles): See Study Guide
Discuss: Unit VII Discussion Board 2%
Submit: Unit VII Case Study 13%
Unit VIII Motivation and Human Resource Management Across Cultures [ Weight: 13% ]
Read/View: Unit VIII Study Guide
Chapter 12: Motivation Across Cultures
Chapter 14: Human Resource Selection and Development Across Cultures, pp. 504539
Discuss: Unit VIII Discussion Board 2%
Submit: Unit VIII Quiz
Unit VIII Essay
2%
9%
BUS 4426, International Management 6
BUS 4426, International Management
Course Syllabus
Course Description
Course Textbook(s)
Course Learning Outcomes
Academic Integrity
Credits
Course Structure
Unit Assignments
Unit III PowerPoint Presentation
Unit VII Case Study
Unit VIII Essay
Submitting Course Papers/Projects
APA Guidelines
Grading Rubrics
Communication Forums
Schedule/Grading
Describe how you, as the surgeon, or nurse, would address a patients religious or spiritual needs if the risks of a complex surgical procedure appear to be threatening.
Choose one of the following videos to address for your assignment.
#1. Wrong-Operation Doctor Attached you will find the transcripts for each video.
Find Out More: You may use these and other outside sources to frame your discussion.
·
The Pain of Wrong Site SurgeryLinks to an external site.
·
Judgment Upheld in Arkansas Brain Surgery LawsuitLinks to an external site.
·
National Quality ForumLinks to an external site.
Assignment Discussion Questions
1. Discuss the issues of integrity in this case.
2. Should criminal charges be considered in this case, if accurately reported? Discuss your answer.
3. Why did you choose to respond to this story?
4. How is integrity displayed in your clinical setting?
#2. Cheneys Staff Cuts Testimony on Warming
Find Out More: You may use these and other outside sources to frame your discussion.
· The full story
Cheney’s Staff Cut Testimony On WarmingLinks to an external site.
·
CDC on Air QualityLinks to an external site.
Assignment Discussion Questions
1. Discuss how headlines such as this affect your opinion of politicians.
2. At the end of our days, the most basic principles of life–trust and survival–are on trial. What is your verdict, if you believe there was a cover-up?.
3. Why did you choose to respond to this story?
4. How are government and political trust displayed in your clinical setting?
#3. Surgeon Uses Ministry in Medical Practice
Find Out More: You may use these and other outside sources to frame your discussion.
· The full story:
Praying with patients: A Dallas surgeon finds a way to put ministry into practiceLinks to an external site.
·
Should Your Doctor Pray With You?Links to an external site.
·
South Korean Hospitals Shut Over MERS Fears; 11th Person DiesLinks to an external site.
· Note the picture in this article
Assignment Discussion Questions
1. Discuss the pressure, if any, placed on the patient to responding to the suggestion of prayer prior to surgery.
2. Describe how you, as the surgeon, or nurse, would address a patients religious or spiritual needs if the risks of a complex surgical procedure appear to be threatening.
3. Why did you choose to respond to this story?
4. How is religion or faith displayed in your clinical setting?
NURS_521_DE – Paper/Essay Rubric
NURS_521_DE – Paper/Essay Rubric
Criteria
Ratings
Pts
This criterion is linked to a Learning OutcomeContent
16 to >13.76 pts
Proficient
The writer clearly and effectively responds to the assignment.
13.76 to >12.0 pts
Approaches Proficiency
The response to the assignment is generally adequate, but may not be thorough.
12 to >0 pts
Does Not Meet Expectations
The writer does not respond to the assignment.
16 pts
This criterion is linked to a Learning OutcomeFocus and Detail
12 to >10.32 pts
Proficient
There is one clear, well-focused topic. Main ideas are clear and are well supported by detailed and accurate information.
10.32 to >9.0 pts
Approaches Proficiency
There is one clear, well-focused topic. Main ideas are clear but are not well supported by detailed information.
9 to >0 pts
Does Not Meet Expectations
The topic and main ideas are not clear.
12 pts
This criterion is linked to a Learning OutcomeOrganization
8 to >6.88 pts
Proficient
The introduction is inviting, states the main topic, and provides an overview of the paper. Information is relevant and presented in a logical order. The conclusion is strong.
6.88 to >6.0 pts
Approaches Proficiency
The introduction states the main topic and provides an overview of the paper. A conclusion is included.
6 to >0 pts
Does Not Meet Expectations
There is no clear introduction, structure, or conclusion.
8 pthe assignment consistently follows current APA format and is free from errors in formatting, citation, and references. No grammatical, spelling, or punctuation errors. All sources are cited and referenced correctly.
3.44 to >3.0 pts
Approaches Proficiency
The assignment consistently follows current APA format with only isolated and inconsistent mistakes and/or has a few grammatical, spelling, or punctuation errors. Most sources are cited and referenced correctly.
3 to >0 pts
Does Not Meet Expectations
The assignment does not follow current APA format and/or has many grammatical, spelling, or punctuation errors. Many sources are cited and referenced incorrectly, or citations and references are missing.
4 pts
Total Points: 40
This exercise should help you see how this tool can be applied to forensic and paternity testing. The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joes sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father. If you were serving on the jury in this case, who would you choose to raise the baby? Why?
Lab 10: Paternity Testing with DNA Fingerprinting
Name: ____________________
Introduction
DNA fingerprinting is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.
The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joes sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.
1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
2. You have been given the following DNA samples:
Mary
CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG
Joe
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG
Dan
CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG
Baby Jacob
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG
3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Marys DNA as an example.
4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the gel that separates DNA by size.
The first restriction fragment produced in Marys DNA has been done for you as an example. It was placed in Marys column because it comes from Marys DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.
5. You have decided to use a probe that is a small piece of DNA with a sequence of GTA that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?
6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the gel above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.
7.
8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as genetic markers. We will now fill in the film to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.
9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Marys baby?
10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?
At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phonea tornado is headed your way. You have 15 minutes before touchdown in your neighborhood. A. What is your plan? This is a shelter in place scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.
See Rubric for additional details.
Your paper should address the following:
Title Page
Introduction – Family Disaster Plan Scenario
A. You must include research on the dangers and explain the recommended safety measures in a tornado emergency.
How would you prepare for the following situation?
(Scenario) At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phonea tornado is headed your way. You have 15 minutes before touchdown in your neighborhood.
A. What is your plan? This is a ‘shelter in place’ scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.
B. Provide realistic examples and explain how you would apply the safety and survival measures you learned in your research of a tornado emergency to your specific living arrangements.
Example: I will turn off my utilities before I shelter in place to mitigate damage to my residence.
Example: I will take by go-bags with me to my shelter in place.
How prepared are you in the event of a disaster?
A. Describe your level of disaster preparedness using specific examples and references to:
1. Potential disasters in your area.
2. Your 72 hour “go-bag” assignment.
3. Family Disaster Plan Checklist.
Example: I am more prepared for a water-related disaster than a fire-related disaster even though I live in a highly secluded, forested area. I have a boat as transportation in the event of flooding, but I do not have rain barrels or fire barrier supplies on hand.
Example: “There were many missing items on my preparedness checklist. I realized that I do not own a flashlight. If I had to use my phone as a light it would drain the battery very quickly.
Reflection/Conclusion
A. Reflect on how prepared you were before this class and compare it with how prepared you are now.
· Have you acquired any new emergency items?
· Do you plan to take any additional training or certification courses?
· Have you shared your knowledge with friends and family?
B. How does what you have learned in this course impact you as a future nurse?
Reference Page
A. Cite and reference at least two (2) scholarly resources using 7th ed APA format.
· Need help with APA Style? Visit the
Student Resources
page
.
2
Policy and Advocacy for Improving Population Health, Comparing APRN Regulations: Full Practice Authority vs. Collaborative Models in New York and Florida
**minimum of three (2) scholarly references are required for each reply cited within the body of the reply & at the end**
Nerline Mildort
Comparing APRN Regulations: Full Practice Authority vs. Collaborative Models in New York and Florida
In New York Advanced Practice Registered Nurses (APRNs), including nurse practitioners (NPs), operate under specific regulations that grant them a degree of autonomy in their practice. On the other hand, in Florida, the regulatory framework for APRNs is different, requiring them to maintain a Collaborative Practice Agreement (CPA) with a physician (Kleinpell et al., 2023). This comparison highlights the distinctions between the two states’ regulations and their potential impact on nursing practice.
New York Regulations
In New York, APRNs, including NPs, have Full Practice Authority (FPA). This means they can practice independently within the full scope of their education and training without needing a CPA with a physician (Kleinpell et al., 2023). They are authorized to diagnose, treat, and prescribe medications, including controlled substances, without mandatory physician oversight.
For example, an NP working in a family practice clinic in New York can conduct patient assessments, order, and interpret diagnostic tests, make treatment decisions, and prescribe medications without supervision from a collaborating physician.
Florida Regulations
In contrast, Florida has a more restrictive regulatory approach for APRNs, including NPs. APRNs in Florida must have a CPA with a physician, which introduces an element of collaboration into their practice (Neff et al., 2018). While NPs in Florida can diagnose and treat patients, certain aspects of their practice, particularly prescribing medications, are influenced by the terms of the CPA.
For instance, an NP in Florida may need to consult with their collaborating physician for certain prescription decisions, and the physician may be required to co-sign these prescriptions. This collaborative model ensures physician involvement in NP practice and adds an extra layer of oversight.
Application to APRNs with Full Scope Practice
The regulations in New York, granting Full Practice Authority to APRNs allow them to operate autonomously, offering timely and comprehensive care to patients (Wheeler et al., 2022). This autonomy can be particularly beneficial in underserved areas where physicians may be scarce, improving access to care and potentially reducing healthcare disparities. In contrast, Floridas regulatory framework, which requires CPAs with physicians, may create administrative hurdles and slow the delivery of care (Wheeler et al., 2022). However, this model can also facilitate collaborative decision-making and ensure an additional layer of clinical oversight.
For example, in a rural clinic in New York, an NP may see patients and prescribe medications independently, whereas, in a similar clinic in Florida, the NP might need to consult with their collaborating physician for certain prescription decisions, adding an extra layer of clinical judgment and expertise.
In conclusion, the regulatory differences between Florida and New York for APRNs, particularly NPs, highlight the varying levels of autonomy and collaboration in their practice. These regulations reflect the states’ approaches to balancing access to care with patient safety, and they have direct implications for how APRNs provide healthcare services within their respective jurisdictions.
References
Florida: Information and Resources for Florida NPs. American Association of Nurse Practitioners. (n.d.-a). https://www.aanp.org/advocacy/florida
Kleinpell, R., Myers, C. R., & Schorn, M. N. (2023). Addressing Barriers to APRN Practice: Policy and Regulatory Implications During COVID-19.
Journal of Nursing Regulation,
14(1), 1320. https://doi.org/10.1016/s2155-8256(23)00064-9
Neff, D. F., Yoon, S. H., Steiner, R. L., Bejleri, I., Bumbach, M. D., Everhart, D., & Harman, J. S. (2018). The impact of nurse practitioner regulations on population access to care.
Nursing Outlook,
66(4), 379385. https://doi.org/10.1016/j.outlook.2018.03.001
New York: Information and Resources for New York NPs. American Association of Nurse Practitioners. (n.d.). https://www.aanp.org/advocacy/new-york
Wheeler, K. J., Miller, M., Pulcini, J., Gray, D., Ladd, E., & Rayens, M. K. (2022). Advanced Practice Nursing Roles, Regulation, Education, and Practice: A Global Study.
Annals of Global Health,
88(1). https://doi.org/10.5334/aogh.3698
Nursing lab assignment: differential diagnosis for skin conditions
SkinComprehensiveSOAPNoteTemplate.docx
Week 4
Skin Comprehensive SOAP Note Template
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC):
History of Present Illness (HPI):
Medications:
Allergies:
Past Medical History (PMH):
Past Surgical History (PSH):
Sexual/Reproductive History:
Personal/Social History:
Health Maintenance:
Immunization History:
Significant Family History:
Review of Systems:
General:
HEENT:
Respiratory:
Cardiovascular/Peripheral Vascular:
Gastrointestinal:
Genitourinary:
Musculoskeletal:
Neurological:
Psychiatric:
Skin/hair/nails:
OBJECTIVE DATA:
Physical Exam:
Vital signs:
General:
HEENT:
Neck:
Chest/Lungs:.
Heart/Peripheral Vascular:
Abdomen:
Genital/Rectal:
Musculoskeletal:
Neurological:
Skin:
Diagnostic results:
ASSESSMENT:
PLAN:
This section is not required for the assignments in this course (NURS 6512), but will be required for future courses.
© 2021 Walden University Page 2 of 3
week4intrototheassignment.PNG
week4preparingtheassignment.PNG
You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?C
1) You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?Compare the area and total dynamic read energy per access of the pipelined design versus the banked design. State which takes up less area and which requires more power and explain why that might be.2) A cache acts as a filter. For example, for every 1000 instructions of a program, an average of 20 memory accesses may exhibit low enough locality that they cannot be serviced by a 2 MB cache. The 2 MB cache is said to have an MPKI (misses per thousand instructions) of 20, and this will be largely true regardless of the smaller caches that precede the 2 MB cache. Assume the following cache/latency/MPKI values: 32 KB/1/100, 128 KB/2/80, 512 KB/4/50, 2 MB/8/40, 8 MB/16/10. Assume that accessing the off-chip memory system requires 200 cycles on average. For the following cache configurations, calculate the average time spent accessing the cache hierarchy. What do you observe about the downsides of a cache hierarchy that is too shallow or too deep?a. 32 KB L1; 8 MB L2; off-chip memoryb. 32 KB L1; 512 KB L2; 8 MB L3; off-chip memoryc. 32 KB L1; 128 KB L2; 2 MB L3; 8 MB L4; off-chip memory3) You are designing a PMD and optimizing it for low energy. The core, including an 8 KB L1 data cache, consumes 1 W whenever it is not in hibernation. If the core has a perfect L1 cache hit rate, it achieves an average CPI of 1 for a given task, that is, 1000 cycles to execute 1000 instructions. Each additional cycle accessing the L2 and beyond adds a stall cycle for the core. Based on the following specifications, what is the size of L2 cache that achieves the lowest energy for the PMD (core, L1, L2, memory) for that given task?The core frequency is 1 GHz, and the L1 has an MPKI of 100.A 256KB L2 has a latency of 10cycles, an MPKI of 20, a background power of 0.2 W, and each L2 access consumes 0.5 nJ.A 1MB L2 has a latency of 20 cycles, an MPKI of 10, a background power of 0.8 W, and each L2 access consumes 0.7 nJ.The memory system has an average latency of 100 cycles, a background power of 0.5 W, and each memory access consumes 35 nJ.4) The ways of a set can be viewed as a priority list, ordered from high priority to low priority. Every time the set is touched, the list can be reorganized to change block priorities. With this view, cache management policies can be decomposed into three sub-policies: Insertion, Promotion, and Victim Selection. Insertion defines where newly fetched blocks are placed in the priority list. Promotion defines how a blocks position in the list is changed every time it is touched (a cache hit). Victim Selection defines which entry of the list is evicted to make room for a new block when there is a cache miss.a. Can you frame the LRU cache policy in terms of the Insertion, Promotion, and Victim Selection sub-policies?b. Can you define other Insertion and Promotion policies that may be competitive and worth exploring further?5) You are trying to appreciate how important the principle of locality is in justifying the use of a cache memory, so you experiment with a computer having an L1 data cache and a main memory (you exclusively focus on data accesses). The latencies (in CPU cycles) of the different kinds of accesses are as follows: cache hit, 1 cycle; cache miss, 110 cycles; main memory access with cache disabled, 105 cycles.When you run a program with an overall miss rate of 3%, what will the average memory access time (in CPU cycles) be?Next, you run a program specifically designed to produce completely random data addresses with no locality. Toward that end, you use an array of size 1 GB (all of which fits in the main memory). Accesses to random elements of this array are continuously made (using a uniform random number generator to generate the elements indices). If your data cache size is 64 KB, what will the average memory access time be?If you compare the result obtained in part (b) with the main memory access time when the cache is disabled, what can you conclude about the role of the principle of locality in justifying the use of cache memory?You observed that a cache hit produces a gain of 104 cycles(1 cycle vs. 105), but it produces a loss of 5 cycles in the case of a miss (110 cycles vs. 105). In the general case, we can express these two quantities as G (gain) and L (loss). Using these two quantities (G and L), identify the highest miss rate after which the cache use would be disadvantageous.