Compare and contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.

Essay
Your first research essay should be a fully completed work of 5 pages (
Body Paragraphs, NOT including Title or Reference Page, or any graphics). Your topic may be related to the development of any idea that has already been expressed as part of the course; your thesis should be a synthesis of carefully documented research and critical analysis of this topic. The essay should incorporate the general parts of an academic essay—an introduction and thesis, a body of specific evidence/support/analysis, and a conclusion that emphasizes the answers to questions you may have asked within your research.

Your writing should address the Core Learning Outcomes of the course and the Instructor Specific Learning Outcomes, as specified on the syllabus. I have included them here for your convenience:
1. Analyze the disciplinary content in its own context and in relationship to the issues, questions, and positions of other disciplines.
2. Compare and contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.
3. Synthesize diverse perspectives to achieve an interdisciplinary understanding.
4. Analyze the relationships among academic knowledge, professional work, and the responsibilities of local and global citizenship.
5. Interpret and critique the possible “real world” connections or behaviors associated with the viewing or playing of media violence.
Instructor Learning Outcomes
1. Identify, discuss, and critique the representations of serial killers as heroes, celebrities, and icons in modern media forms. Explain the characteristics of the media forms, genres, and methods for each subject.
2. Describe and analyze the popular culture forms that encourage audience identification or participation through violence or vicarious experience.
3. Evaluate multiple perspectives, modes of inquiry and expression, and processes for decision-making in the disciplines.
Specifics
Your essay should conform to the MLA format for citations within the text and in your works cited. Therefore, your writing should be double-spaced, with one-inch margins, in a 10-12-pitch font. The grading of this essay will be based upon the objective skills we have focused upon in our course lectures and discussions—incorporating your research sources seamlessly within your own writing, building upon your skills as a “close-reading” expert, and analysis of your topic, and answering the larger questions about “why” we are studying serial killers as heroes (as well as, “why” your topic is popular? important? significant? worthy of study? definitive of its audience?)
Resources
You should carefully construct your essay by looking at the examples we have studied within our course—the popular culture essays that have been part of your reading assignments, our in-class examples, and the writing process that has been investigated in our class assignments (Reader Response Essays, Discussion Postings, etc.).

This is an enhanced, clearer version of the instructions from the Week 8 Module. Clarifications from me are in brackets/blue and important points are bolded. You should start planning this essay NOW to avoid stress and frustration. Working in “small bites” is always the best way to approach large projects.

Assignment

Paper: Your Final Research Essay should be a
fully completed work of 5 pages [
body only – NOT including Title Page, Sources, graphics/charts or other elements]. Your topic may be
related to the development of any idea that has already been expressed as part of the course [you can write about
anything –
your choice – as long as it’s
related to the class materials and topics. Think about what interested you particularly and if you have questions, send the idea to me and I’ll be happy to review it].

Ideas were provided for the
Midterm that would work here (though you
cannot
rehash your Midterm). You can choose from any of the materials/subjects from Weeks 1-7 for this essay, not only the first three weeks. Craft these example prompts in a way you want with the subjects you want and you will have a topic. You can, of course, develop your own topic and approach.

Example questions/topics from Midterm instructions:

· You may
compare and contrast the way
literary analysis would analyze 
Darkly Dreaming Dexter [or any novel]
differently than
a film analysis would be of the TV series [or movie].  How does Dexter’s “heroic” vigilantism bleed into the real world?

· You may
compare or contrast the film analysis of Alfred Hitchcock’s 
Psycho with the
medical or psychological diagnosis of Norman Bates.  Is it possible to learn from the film’s fiction to allow us to see a “real world” perspective on serial killers?

· How would a
criminal justice perspective on Hannibal Lecter differ from a
social psychological profile?  How does our academic knowledge change our viewing of the film? 

Other options could be analyzing how the movies/ TV series or novels were reviewed, analysis of characters or other elements, the connection between the fictional characters and real-life criminals (who were often the basis for the fictional characters), WHY the market for anything “serial killer related” is so huge or anything else you want to explore. Do not forget to start with a
Research Question about your topic, the
answer to which (through research) will be your
Thesis Statement.

Your
Thesis Statement should be a
synthesis of carefully documented research and critical analysis of this topic. Note that the Thesis Statement is an assertive
statement and
never
a question. The essay should
incorporate the general parts of an academic essay—an Introduction and Thesis, a body of specific evidence/support/analysis, and a conclusion that emphasizes the answers to questions you may have asked within your research.

Your writing should address the
Core Learning Outcomes of the course as specified on the syllabus.

I have included the Outcomes here for your convenience [include/demonstrate as many as you can]:
1.
Analyze the disciplinary content
in its own context and in relationship to the issues, questions, and positions of other disciplines.

2.
Compare and
contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.

3.
Synthesize diverse perspectives to achieve an interdisciplinary understanding.

4.
Analyze the relationships among
academic knowledge, professional work, and the responsibilities of local and global citizenship.

5.
Interpret and critique the possible
“real world” connections or behaviors associated with the viewing or playing of media violence.

Instructor Learning Outcomes:

1.
Identify, discuss and critique the representations of serial killers as heroes, celebrities, and icons in modern media forms. Explain the characteristics of the media forms, genres, and methods for each subject.

2.
Describe and analyze the popular culture forms that encourage audience identification or participation through violence or vicarious experience.

3.
Evaluate multiple perspectives, modes of inquiry and expression, and processes for decision-making in the disciplines.

Specifics

Your essay should conform to the
MLA format [I’ll also accept APA – just make sure you don’t mix the styles] for
citations within the text and in your
Works Cited [or Reference]
Page. Therefore, your writing should be double-spaced, with one-inch margins, in a 10-12-pitch font. The grading of this essay will be based upon the objective skills we have focused on in our course lectures and discussions—incorporating your research sources seamlessly within your own writing, building upon your skills as a “close-reading” expert and analysis of your topic, and answering the larger questions about “why” we are studying serial killers as heroes (as well as, “why” your topic is popular? important? significant? worthy of study? definitive of its audience?)

Resources

You should carefully construct your essay by looking at the
examples we have studied within our course—
the popular culture essays that have been part of your reading assignments, our in-class examples, and the writing process that has been investigated in our class assignments (Midterm Essay, Discussion Postings, etc). [You can include any of the sources I’ve posted in
Discussion or
Doc Sharing or any other
credible sources you find on your own]. Below are links to information on the two styles:

MLA

APA

This exercise should help you see how this tool can be applied to forensic and paternity testing. The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

Lab 10: Paternity Testing with DNA Fingerprinting

Name: ____________________

Introduction

DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.
The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.
1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
2. You have been given the following DNA samples:

Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG

Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG

Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG

Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary’s DNA as an example.
4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.
5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?
6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.
7.
8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.
9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?

10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood.  A. What is your plan? This is a shelter in place scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.

See Rubric for additional details.

Your paper should address the following:

Title Page

Introduction – Family Disaster Plan Scenario

A. You must include research on the dangers and explain the recommended safety measures in a tornado emergency.

How would you prepare for the following situation?

(Scenario) At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood. 

A. What is your plan? This is a ‘shelter in place’ scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.
B. Provide realistic examples and explain how you would apply the safety and survival measures you learned in your research of a tornado emergency to your specific living arrangements.

Example: “I will turn off my utilities before I shelter in place to mitigate damage to my residence.”

Example: “I will take by “go-bags” with me to my shelter in place.

How prepared are you in the event of a disaster?

A. Describe your level of disaster preparedness using specific examples and references to:
1. Potential disasters in your area.
2. Your 72 hour “go-bag” assignment.
3. Family Disaster Plan Checklist.

Example: “I am more prepared for a water-related disaster than a fire-related disaster even though I live in a highly secluded, forested area. I have a boat as transportation in the event of flooding, but I do not have rain barrels or fire barrier supplies on hand.”

Example:  “There were many missing items on my preparedness checklist. I realized that I do not own a flashlight. If I had to use my phone as a light it would drain the battery very quickly. 

Reflection/Conclusion

A. Reflect on how prepared you were before this class and compare it with how prepared you are now. 
· Have you acquired any new emergency items?
· Do you plan to take any additional training or certification courses?
· Have you shared your knowledge with friends and family? 
B. How does what you have learned in this course impact you as a future nurse?

Reference Page

A. Cite and reference at least two (2) scholarly resources using 7th ed APA format.
· Need help with APA Style?  Visit the 

Student Resources
 page

.

2

Policy and Advocacy for Improving Population Health, Comparing APRN Regulations: Full Practice Authority vs. Collaborative Models in New York and Florida

**minimum of three (2) scholarly references are required for each reply cited within the body of the reply & at the end**

Nerline Mildort

Comparing APRN Regulations: Full Practice Authority vs. Collaborative Models in New York and Florida

In New York Advanced Practice Registered Nurses (APRNs), including nurse practitioners (NPs), operate under specific regulations that grant them a degree of autonomy in their practice. On the other hand, in Florida, the regulatory framework for APRNs is different, requiring them to maintain a Collaborative Practice Agreement (CPA) with a physician (Kleinpell et al., 2023). This comparison highlights the distinctions between the two states’ regulations and their potential impact on nursing practice.

New York Regulations

In New York, APRNs, including NPs, have Full Practice Authority (FPA). This means they can practice independently within the full scope of their education and training without needing a CPA with a physician (Kleinpell et al., 2023). They are authorized to diagnose, treat, and prescribe medications, including controlled substances, without mandatory physician oversight.
For example, an NP working in a family practice clinic in New York can conduct patient assessments, order, and interpret diagnostic tests, make treatment decisions, and prescribe medications without supervision from a collaborating physician.

Florida Regulations

In contrast, Florida has a more restrictive regulatory approach for APRNs, including NPs. APRNs in Florida must have a CPA with a physician, which introduces an element of collaboration into their practice (Neff et al., 2018). While NPs in Florida can diagnose and treat patients, certain aspects of their practice, particularly prescribing medications, are influenced by the terms of the CPA.
For instance, an NP in Florida may need to consult with their collaborating physician for certain prescription decisions, and the physician may be required to co-sign these prescriptions. This collaborative model ensures physician involvement in NP practice and adds an extra layer of oversight.

Application to APRNs with Full Scope Practice

The regulations in New York, granting Full Practice Authority to APRNs allow them to operate autonomously, offering timely and comprehensive care to patients (Wheeler et al., 2022). This autonomy can be particularly beneficial in underserved areas where physicians may be scarce, improving access to care and potentially reducing healthcare disparities. In contrast, Florida’s regulatory framework, which requires CPAs with physicians, may create administrative hurdles and slow the delivery of care (Wheeler et al., 2022). However, this model can also facilitate collaborative decision-making and ensure an additional layer of clinical oversight.
For example, in a rural clinic in New York, an NP may see patients and prescribe medications independently, whereas, in a similar clinic in Florida, the NP might need to consult with their collaborating physician for certain prescription decisions, adding an extra layer of clinical judgment and expertise.
In conclusion, the regulatory differences between Florida and New York for APRNs, particularly NPs, highlight the varying levels of autonomy and collaboration in their practice. These regulations reflect the states’ approaches to balancing access to care with patient safety, and they have direct implications for how APRNs provide healthcare services within their respective jurisdictions.
 
References

Florida: Information and Resources for Florida NPs. American Association of Nurse Practitioners. (n.d.-a). https://www.aanp.org/advocacy/florida

Kleinpell, R., Myers, C. R., & Schorn, M. N. (2023). Addressing Barriers to APRN Practice: Policy and Regulatory Implications During COVID-19. 
Journal of Nursing Regulation, 
14(1), 13–20. https://doi.org/10.1016/s2155-8256(23)00064-9

Neff, D. F., Yoon, S. H., Steiner, R. L., Bejleri, I., Bumbach, M. D., Everhart, D., & Harman, J. S. (2018). The impact of nurse practitioner regulations on population access to care. 
Nursing Outlook, 
66(4), 379–385. https://doi.org/10.1016/j.outlook.2018.03.001

 
New York: Information and Resources for New York NPs. American Association of Nurse Practitioners. (n.d.). https://www.aanp.org/advocacy/new-york

Wheeler, K. J., Miller, M., Pulcini, J., Gray, D., Ladd, E., & Rayens, M. K. (2022). Advanced Practice Nursing Roles, Regulation, Education, and Practice: A Global Study. 
Annals of Global Health, 
88(1). https://doi.org/10.5334/aogh.3698

Nursing lab assignment: differential diagnosis for skin conditions

SkinComprehensiveSOAPNoteTemplate.docx

Week 4

Skin Comprehensive SOAP Note Template

Patient Initials: _______ Age: _______ Gender: _______

SUBJECTIVE DATA:

Chief Complaint (CC):

History of Present Illness (HPI):

Medications:

Allergies:

Past Medical History (PMH):

Past Surgical History (PSH):

Sexual/Reproductive History:

Personal/Social History:

Health Maintenance:

Immunization History:

Significant Family History:

Review of Systems:

General:

HEENT:

Respiratory:

Cardiovascular/Peripheral Vascular:

Gastrointestinal:

Genitourinary:

Musculoskeletal:

Neurological:

Psychiatric:

Skin/hair/nails:

OBJECTIVE DATA:

Physical Exam:

Vital signs:

General:

HEENT:

Neck:

Chest/Lungs:.

Heart/Peripheral Vascular:

Abdomen:

Genital/Rectal:

Musculoskeletal:

Neurological:

Skin:

Diagnostic results:

ASSESSMENT:

PLAN:
This section is not required for the assignments in this course (NURS 6512), but will be required for future courses.

© 2021 Walden University Page 2 of 3

week4intrototheassignment.PNG

week4preparingtheassignment.PNG

You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?C

1) You have been asked to investigate the relative performance of a banked versus pipelined L1 data cache for a new microprocessor. Assume a 64 KB two-way set associative cache with 64-byte blocks. The pipelined cache would consist of three pipe stages, similar in capacity to the Alpha 21264 data cache. A banked implementation would consist of two 32 KB two-way set associative banks. Use CACTI and assume a 65 nm (0.065 m) technology to answer the following questions. The cycle time output in the web version shows at what frequency a cache can operate without any bubbles in the pipeline.What is the cycle time of the cache in comparison to its access time, and how many pipe stages will the cache take up (to two decimal places)?Compare the area and total dynamic read energy per access of the pipelined design versus the banked design. State which takes up less area and which requires more power and explain why that might be.2) A cache acts as a filter. For example, for every 1000 instructions of a program, an average of 20 memory accesses may exhibit low enough locality that they cannot be serviced by a 2 MB cache. The 2 MB cache is said to have an MPKI (misses per thousand instructions) of 20, and this will be largely true regardless of the smaller caches that precede the 2 MB cache. Assume the following cache/latency/MPKI values: 32 KB/1/100, 128 KB/2/80, 512 KB/4/50, 2 MB/8/40, 8 MB/16/10. Assume that accessing the off-chip memory system requires 200 cycles on average. For the following cache configurations, calculate the average time spent accessing the cache hierarchy. What do you observe about the downsides of a cache hierarchy that is too shallow or too deep?a. 32 KB L1; 8 MB L2; off-chip memoryb. 32 KB L1; 512 KB L2; 8 MB L3; off-chip memoryc. 32 KB L1; 128 KB L2; 2 MB L3; 8 MB L4; off-chip memory3) You are designing a PMD and optimizing it for low energy. The core, including an 8 KB L1 data cache, consumes 1 W whenever it is not in hibernation. If the core has a perfect L1 cache hit rate, it achieves an average CPI of 1 for a given task, that is, 1000 cycles to execute 1000 instructions. Each additional cycle accessing the L2 and beyond adds a stall cycle for the core. Based on the following specifications, what is the size of L2 cache that achieves the lowest energy for the PMD (core, L1, L2, memory) for that given task?The core frequency is 1 GHz, and the L1 has an MPKI of 100.A 256KB L2 has a latency of 10cycles, an MPKI of 20, a background power of 0.2 W, and each L2 access consumes 0.5 nJ.A 1MB L2 has a latency of 20 cycles, an MPKI of 10, a background power of 0.8 W, and each L2 access consumes 0.7 nJ.The memory system has an average latency of 100 cycles, a background power of 0.5 W, and each memory access consumes 35 nJ.4) The ways of a set can be viewed as a priority list, ordered from high priority to low priority. Every time the set is touched, the list can be reorganized to change block priorities. With this view, cache management policies can be decomposed into three sub-policies: Insertion, Promotion, and Victim Selection. Insertion defines where newly fetched blocks are placed in the priority list. Promotion defines how a block’s position in the list is changed every time it is touched (a cache hit). Victim Selection defines which entry of the list is evicted to make room for a new block when there is a cache miss.a. Can you frame the LRU cache policy in terms of the Insertion, Promotion, and Victim Selection sub-policies?b. Can you define other Insertion and Promotion policies that may be competitive and worth exploring further?5) You are trying to appreciate how important the principle of locality is in justifying the use of a cache memory, so you experiment with a computer having an L1 data cache and a main memory (you exclusively focus on data accesses). The latencies (in CPU cycles) of the different kinds of accesses are as follows: cache hit, 1 cycle; cache miss, 110 cycles; main memory access with cache disabled, 105 cycles.When you run a program with an overall miss rate of 3%, what will the average memory access time (in CPU cycles) be?Next, you run a program specifically designed to produce completely random data addresses with no locality. Toward that end, you use an array of size 1 GB (all of which fits in the main memory). Accesses to random elements of this array are continuously made (using a uniform random number generator to generate the elements indices). If your data cache size is 64 KB, what will the average memory access time be?If you compare the result obtained in part (b) with the main memory access time when the cache is disabled, what can you conclude about the role of the principle of locality in justifying the use of cache memory?You observed that a cache hit produces a gain of 104 cycles(1 cycle vs. 105), but it produces a loss of 5 cycles in the case of a miss (110 cycles vs. 105). In the general case, we can express these two quantities as G (gain) and L (loss). Using these two quantities (G and L), identify the highest miss rate after which the cache use would be disadvantageous.

Discuss and analyze the arguments for and against Milton Friedman’s thesis that the only purpose of business is to make money.

Purpose: In this project, you will discuss and analyze the arguments for and against Milton Friedman’s thesis that the only purpose of business is to make money. You will apply the arguments for and against to a specific ethical issue that you have previously discussed in a weekly discussion. Learning outcome met by completing this project Identify ethical issues that arise in domestic and global business environments using an understanding of ethical concepts and of legal and business principles. How to Set Up the Paper Create a Word or Rich Text Format (RTF) document that is double-spaced, 12-point font. The format should be in memo form. The final product will be between 5-7 pages in length excluding the title page and reference page. Write clearly and concisely. Instructions You serve as the assistant to the very recently appointed CEO of a prominent start-up that is beginning to grow rapidly. The new CEO, Tara Richmond, is a former general who gained visibility in the military for her outstanding leadership qualities. Since her arrival, the Board of Directors has had spirited debates on several proposals that would increase corporate profits but would work to the disadvantage of some members of the public as well as other stakeholders. Some members of the board are arguing that the only obligation the company has is to make profits for the stockholders. Other members of the board are arguing that the company has an obligation to the community and to stakeholders other than just the stockholders. Your boss is baffled by the debate. “When I was in the military, my duties to others were clearly laid out. Here, I am unsure to whom the company owes a duty.” She turns to you for advice, requesting that you draft a memo that explains what the company’s ethical obligations are in situations like these. She asks you to start with Milton Friedman’s opinion piece in 1970, arguing that a company’s only ethical responsibility is to make profits. That can be found here. She also asks you to review a much more recent memo from the Business Roundtable that takes a more expansive view of the responsibilities of a company. The Business Roundtable consists of CEOs of Fortune 500 companies, many of whom are familiar names to her. That memo can be found here. You should do additional research on arguments for and against Friedman’s proposition. Using your classroom materials as well as external sources, respond to the following prompts: 1. Explain Milton Friedman’s arguments supporting that a company’s only obligation is to make money. 2.Explain the arguments contrary to Friedman’s position including where the Business Roundtable stands as well as other arguments you find in your research. 3.Using one of the ethical issues that you posted in classroom discussions, illustrate for the CEO, how that issue would be resolved using Friedman’s perspective and how it would be resolved using the perspective of the Business Roundtable. 4.Which of these positions do you find most compelling and why? Your memo should begin with an introduction and end with a conclusion where you make recommendations to the CEO. Course Material and Research This project requires you to do research on UMGC Library Databases or on the Internet. You are expected to use course material going beyond defining terms. You are expected to explain the ‘why and how’ of a situation. Avoid merely making statements but close the loop of the discussion by explaining how something happens or why something happens, which focuses on importance and impact. In closing the loop, you will demonstrate the ability to think clearly and rationally showing an understanding of the logical connections between the course material and the question(s) being asked. Using one or two in-text citations from the course material throughout the entire paper will not earn many points on the assignment. The support must be relevant and applicable to the topic being discussed. Points are not earned for mentioning a term or concept but by clearly and thoroughly explaining or discussing the question at hand. Use this link: BMGT 496 New Project 2 Template (4).docx to complete this project. Third person writing is required. Third person means that there are no words such as “I, me, my, we, or us” (first person writing), nor is there use of “you or your” (second person writing). If uncertain how to write in the third person, view this. Contractions are not used in business writing, so do not use them. Paraphrase and do not use direct quotation marks. Paraphrase means you do not use more than four consecutive words from a source document. Instead put a passage from a source document into your own words and attribute the passage to the source document by using an in-text citation. Changing words from a passage does not exclude the passage from being a direct quote. If more than four consecutive words are used from source documents, this material will not be included in the grade and could lead to allegations of academic dishonesty. Use in-text citations and provide a reference list that contains the reference associated with each in-text citation. Note that a reference within a reference list cannot exist without an associated in-text citation and vice versa. You are expected to use the weekly course materials to develop the analysis and support the reasoning. See the module, Learn How to Support What You Write. There should be a robust use of the course materials along with a thorough analysis. The citations must contain the title of the eBook, the chapter title and year. The case scenario facts are not cited but do not use more than four consecutive words when completing the project. If more than four consecutive words are used from source documents, this material will not be included in the grade and could lead to allegations of academic dishonesty.

Describe the key functions in the body of the biomolecules you studied in this virtual lab AND include key structural details. a. Carbohydrates b. Proteins

CHEM120OX, Week 7 OL Lab

Virtual Lab Week 7: Introduction to Food Macromolecules

Learning Objectives

· Understand the types of macromolecules found in food
· Understand the structure of carbohydrates, proteins, and lipids
· Detect macromolecules in food samples

Introduction

Macromolecules are very large molecules created by the polymerization of small units called monomers. Most of the macromolecules are present in everyday life, for instance in food.

Learn about biological macromolecules

There are several types of biological macromolecules: carbohydrates, proteins, lipids and nucleic acids. All macromolecules, except lipids, are polymers. A polymer is a long molecule composed of chains of monomers. Monomers are small molecules that serve as building blocks of polymers. In addition, there are also oligomers in nature. Oligomers are molecular complexes composed of a few monomer units, instead of the theoretical unlimited number of monomers. Dimers and trimers are oligomers composed of two and three monomers, respectively, such as lactose in milk for instance. However, in biochemistry, an oligomer usually refers to a macromolecular complex formed by non-covalent bonding of a few macromolecules, such as nucleic acids or proteins. An example is the oligomers found in many neurodegenerative diseases, such as the alpha-synuclein aggregations in Parkinson’s disease.

Help your friend with your macromolecule knowledge

In the Introduction to Food Macromolecules simulation, you will help your friend get a healthy diet and investigate the types of macromolecules found in food. By performing a series of biochemistry tests, you will know the contents of various food items.
Can you use your macromolecule knowledge to convince your friend to change her diet to a healthier one?

Study the transcription and translation processes

Begin by learning about the transcription process of DNA to RNA. Discover the translation process where an RNA sequence is read by a ribosome inside a cell and the corresponding to amino acids are made. With these two processes any protein can be made. How do the amino acids form different proteins?

Synthesis of proteins from amino acids

Find out how amino acids are assembled to make proteins. A 3D animation describes how triplets of codons in the RNA sequence are translated into amino acids. Observe how these amino acids are joined together by peptide bonds to create a polypeptide chain: this is the primary structure of a protein. Then watch as the primary structure is folded into secondary, tertiary and quaternary structures. Discover the two main types of secondary structure and see an example of how the tertiary structure of a protein can be modified post-translation.

Part 1: Complete Labster Lab: Introduction to Food Macromolecules

Purpose: Describe in complete sentences and in your own words, the purpose of this experiment.

Observations: Record three observations from the simulation.

Answer the questions below

1. Describe the key functions in the body of the biomolecules you studied in this virtual lab AND include key structural details.
a. Carbohydrates
b. Proteins
c. Lipids
2. Choose a food in your house. What are some of the biomolecules you expect to be in this food and why?

Part 2: Complete Labster Lab: Introduction to Protein Synthesis

3. In your own words, describe the process of gene expression beginning from the nucleus to the formation of the polypeptide sequence.
4. Complete the table below (2 points):

Nucleic acid

Amine Bases Present

Location(s) in cell

DNA

RNA

5. Assume that RNA Polymerase will read the parental strand of DNA given here and write the mRNA sequence that would result: – TATGCTTCCGTA –
Reflection: Consider what you learned from the two simulations. Reflect on three to four key concepts that you learned in this lab exercise. How could the lessons have learned in this virtual lab related to a real world situation in the community/world or your future career? Be specific in your answer (this should require 5-10 sentences).

Grading Rubric: 

Activity 

Deliverable 

Points 

Part I

Complete Week 7 Virtual Lab: Introduction to Macromolecules Simulation

10

Part II  

Complete the Introduction to Protein Synthesis simulation

10

Part III

Complete lab report and answer questions 
· Purpose (1 point) 
· Observation (3 points)  
· Questions (6 points) 
· Reflection (5 points)

15

Total  

Complete all lab activities  

35

1

What is your initial opinion of Wikipedia’s credibility? What is your experience with Wikipedia? What have people told you? What is your surface opinion?

Americans believe childhood is a distinct time of life, and that schools have a responsibility to protect children from physical and emotional danger, exposure to disturbing information, as well as from the “undesirable” elements of society.
Americans make age requirements for exposure to adult situations and risks: movies are rated to exclude children under a certain age, there are minimum age requirements to purchase cigarettes, alcohol, and pornography. Similarly, the responsibilities of driving, signing contracts, getting married, or serving in the military are all limited by age.
In schools, the expectation that children should be protected from some information is most evident in the use of textbooks and the control of the school library. But wait. A SmartPhone can access any digital information in the world, translate it to your language, and read it to you. Infants play with their parents’ SmartPhones; a two or three year old can use an iPad, and a four year old can use many SmartPhone apps before he or she can read.
Will schoolbooks, textbooks and school libraries be replaced by Wikipedia?
Textbooks were not prevalent in American schools until the mid-1800s, when William McGuffey wrote the first series of readers. Prior to the rise of the textbook, children studied
primary

sources — newspapers, authentic literature, correspondence with relatives, compendia of information in history or science, and other treatises written for adults. And the Bible, of course. With the definition of childhood as a special stage in human development that should be protected, and with the rise of the public schools, textbooks became more prevalent.
Textbooks offer standardization of content, as well as standardization of instruction. However, the content of textbooks is always an area of controversy, almost as much as the Internet is an area of controversy. At times the controversy concerns content that is “appropriate” for children, such as including human reproduction in biology textbooks, or including The Scarlet Letter in literature anthologies.
At other times, textbooks are defended because competitive media, such as some software and the Internet, are not edited especially for children. When everyone has access to everything, how can it matter what’s in a textbook? This is a conflict of values that the growing influence of the Internet, smart phones, and hand-held devices causes us to examine.

Read

· Wales, J. TED Talk: The birth of Wikipedia.

· Cortez, M. B. “Should you use wikipedia as a reliable source? Scientists think so.” Ed Tech Magazine. December 14, 2017

https://edtechmagazine.com/higher/article/2017/12/wikipedia-trustworthy-academic-resource-scientists-think-so

· Sahut, G., Tricot, A. Wikipedia: an opportunity to rethink the links between sources’ credibility, trust and authority. First Monday, University of Illinois at Chicago Library, 2018, 22 (11), page 10 to end.

https://firstmonday.org/ojs/index.php/fm/article/view/7108/6555

· Jona, K., Penza, T.M., Gutmann, J., Muehlich, S., Zolk, O., Wojnowski, L. Renke Maas, Stefan Engelhardt, Antonio Sarikas. Accuracy and completeness of drug information in wikipedia: A comparison with standard textbooks of pharmacology.

DOI: 10.1371/journal.pone.0106930

· Jemielniak, D. (2019, December 8). Wikipedia: Why is the common knowledge resource still neglected by academics? PubMed Central.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6889752/

Links to an external site.

Links to an external site.

Links to an external site.

Links to an external site.

Links to an external site.

Links to an external site.

Write

a brief essay describing Wikipedia’s reputation and credibility. Imagine Wikipedia in comparison to other encyclopedias, not to peer-reviewed scientific literature. Address three perspectives:

· Your personal experience. What is your initial opinion of Wikipedia’s credibility? What is your experience with Wikipedia? What have people told you? What is your surface opinion?
· Wikipedia’s stated purpose. What is the purpose of Wikipedia? What is Wikipedia’s expectation for accuracy? What is Wikipedia’s statement concerning validity? How does Wikipedia judge itself? How does it select the writers?
· Research. Now dive in and consider the expert evaluations and opinions on Wikipedia’s validity. Dive into the research. Cite at least two experts or research studies. What is community-based credibility? Has the credibility of Wikipedia changed over time?

Write
an essay, not short answers as if this is a quiz. Consider my questions as you respond in essay format. Include at least two citations to these or other references.

There are scientific concerns about the effects of GMOs on the environment and on humans when they ingest the food.  If you were on the board of a company that is faced with using GMO or non-GMO suppliers, discuss what position Milton Friedman might take on this issue.

BUS 230 CLASS

Assignment: Unit 03: Legal Reasoning

Q1. Many companies have taken the position that their products have no GMOs. In the United States, foods that contain ingredients derived from corn, soy, canola, and sugar beets have usually been genetically modified. Sixty-four countries around the world have required that GMO foods be labeled. A 2015 survey from ABC News founds that 93% of Americans believe that GMO foods should be labeled.
On the other hand, many scientists and political leaders have argued that the use of GMOs has permitted the United States to grow more food, food that supplies those who are starving throughout the world. Former Governor Mitch Daniels of Indiana maintains that the intentional starvation of people is callous and cruel, but he also believes that denying the world the benefits of increased food production from GMOs carries no moral distinction in resulting starvation. 
There are scientific concerns about the effects of GMOs on the environment and on humans when they ingest the food. 
If you were on the board of a company that is faced with using GMO or non-GMO suppliers, discuss what position Milton Friedman might take on this issue.
Q2. Using the facts in question 1, discuss how Edward Freeman would address the issue the company faces.
Q3. Andy Puzder, once a candidate for secretary of labor in the Trump administration, has written, “When a store closes, the minimum wage for your lost job is zero.” Mr. Puzder believes that increases in minimum wage destroy jobs and hurt working class Americans. What readings and cases in Unit 3 provide support for Mr. Puzder’s view? Which readings and cases would take a different view?
Q4. Who are the stakeholders in those situations in which pharmaceutical companies substantially increase the prices of their drugs?
Q5. What would Milton Friedman say about the pharmaceutical price increases?

Assignment: Unit 05: Legal Reasoning

Q1. What types of ethical issues did you see in the cases on contract formation?
Q2. Describe the stakeholders involved in the case of excessive use of returning goods.
Q3. Explain the conflicts of interest issues in pension funding.
Q4. Regarding the Stanford University research funding case (Case 5.9), discuss whether Stanford was in a gray area in terms of its overhead reimbursement requests. Be sure to list any other rationalizations Stanford used with regard to its conduct.
Q5. Make a list of the legal issues that created confusion in the dispute between Katy Perry and the nuns from the Los Angeles convent. Discuss the impact on the various stakeholders of these points of legal confusion.

Assignment: Unit 06: Legal Reasoning

Q1. Gingham Best, Inc. is a US company with clothing production facilities around the world. Gingham is concerned about conditions in the factories with which it has production contracts. What advice can you offer Gingham for preventing a public relations crisis or a boycott over factory conditions?
Q2. You have just been put in charge of supervising all of your company’s offices around the world. What will you do to be certain that there are no FCPA violations?
Q3. You have been given the task of analyzing whether your company should expand its operations into a particular country. There are concerns about risk in that country. Based on the cases that you have studied, what would you examine in that country to provide input on risk?

Assignment: Unit 07: Legal Reasoning

Q1. Regarding the Kodak Appraiser case (7.10), explain the scheme that the participants used to reduce Kodak’s taxes, and what ethical issues arose.
Q2. Based on the case readings, what components of an employer romance policy could reduce the tensions and other problems that might arise?
Q3. If you were developing a policy to give employees about blogging, what would you include based on the readings and cases?
Q4. Regarding the case involving the Welch/Wetlaufer affair, discuss how that private relationship affected the workplace for both parties (Ms. Wetlaufer and Mr. Welch).
Q5. Using Reading 7.22 on performance evaluations and Case 7.23 on the denial of a partnership to Ann Hopkins, make a list of the things the partners should have done differently in performing partner evaluations.
COMP 110
Module 1 Discussion Questions
Q2. How do the following technologies help you in your quest to become a digital citizen: kiosks, enterprise computing, natural language processing, robotics, and virtual reality?
Q3. What additional uses of technology can you see in the workplace? List ways technology impacts other careers not discussed in this module, such as finance, government, non-profits, and agriculture.
Module 1 Critical Thinking Activities
Q1. You work in the educational software industry. Your boss asks you to give a brief lecture to other employees about the digital divide. Create a one-page document in which you define and give examples of the impact of the digital divide, and list ways your company can work to narrow the gap between students without reliable access to educational software, the Internet, and the hardware on which to run both. Discuss the ethical ramifications of not addressing the digital divide—what is your role as a company?
Q2. You and your roommate decide to reduce your environmental impact by recycling more, going paperless, and using environmentally safe cleaning products. You know you also can use green computing tactics to reduce electronic waste, minimize power use, and more. Create a list of five reasons why you should add green computing to your efforts. List 10 ways you can apply green computing to your daily life.
Q3. Research the trend of BYOD in workplaces. Compare the advantages to any potential disadvantages. Do you think more companies should adopt this policy? Why or why not?
WEEK 8

CENGAGE

Assignment: The Verge Tech Essay Submittal

1. Open a new Microsoft® Word document, and enter your answer to one of the prompts below:
0. Select two articles from the RSS feed, one that details a concern related to the previous modules and one that explains a new technology or service. Summarize each article and include a concluding paragraph that explains how you as a working professional would use this information.
0. Scan the articles that appeared over the last two weeks.  Use those articles to create your own one-page summary of significant innovations or concerns over the last two weeks and the major events that have occurred.
0. Select one article that is of particular interest to you.  Perform additional internet research on that topic and then write a summary of that article.  Include why you were interested in the article, what you learned from it, and how you could use it in your career as a working professional.
1. Save the file on your computer with your last name in the file name. (Example: chapter_01_essay_Jones.doc)
2. Click the Choose File button below to find and select your saved document, and then click Submit Assignment for Grading.