Identify your selected film, including writer, director, year of release, and genre. Describe the ways in which your chosen film has impacted society or how it has called attention to a particular social issue (i.e., politically or culturally, positive or negative).

You are encouraged to incorporate writing from your Week 2 and Week 3 assignments only after you have reflected on your instructor’s feedback and revised the relevant parts of the essays accordingly. Additionally, refer to the outline template in the Week 4 assignment. As you are incorporating your previous work, be sure to consider the broader requirements and context of this assignment, especially regarding film as a medium of social commentary. Do not simply cut and paste material but rather use it as a building block to construct a new paper addressing this prompt’s requirements.
This final film critique is your opportunity to combine the previously addressed elements from Weeks’ 2 and 3 papers into analyzing one film and how it might influence society or shine a light on a social issue.
Please choose a film from this 

List of Approved Films

 Download List of Approved Films
. Review the 

Week 5 Sample Paper

 Download Week 5 Sample Paper

.

Note: You should watch your chosen film twice—once to ensure that you have grasped the storytelling and once more to specifically analyze scenes, techniques, and elements of the film for your paper. If you would like to write about a film not listed, you must contact your professor to request approval in advance or you may not receive credit for this assignment.

 

Write: 

In your introductory paragraph,
· Identify your selected film, including writer, director, year of release, and genre..
· Summarize the film in which you apply your knowledge of the difference between the film’s story and its plot.
· Describe one of the broad theories you have learned about in class (auteur theory, genre theory, formalist theory) that you will use to analyze your film in this paper.
· Develop a thesis statement that describes how the specific elements of your chosen film work together to communicate themes relating to a particular social issue.
· Visit the 

Writing a Thesis Statement

Links to an external site.
 resource from the UAGC Writing Center.

In the body of your paper,
· Analyze your selected film using one of the broad theories you have learned about in class (auteur theory, genre theory, formalist theory).
· Evaluate the use of three specific techniques and design elements employed in the film as they contribute to the overarching narrative, theme, and social commentary of your chosen film. This can include elements of mise-en-scène (e.g., lighting, sound, composition of frame, costuming, etc.) and editing (e.g., cuts and transitions, shots used, angles, etc.).
· Describe the ways in which your chosen film has impacted society or how it has called attention to a particular social issue (i.e., politically or culturally, positive or negative).
In the conclusion of your paper,
· Draw connections between each element of your chosen film and how they contribute to the film’s overall stance on a particular social issue, if it is effective in doing so, and why addressing this issue is necessary to society.
 
Final Film Critique: Film and Social Resonance Analysis final paper
· Must be five to six double-spaced pages (1500 to 1800 words) in length (not including title page and references) and formatted according to 

APA Style

Links to an external site.
 as outlined in the Writing Center’s 

APA Formatting for Microsoft WordLinks to an external site.

· Must include a separate title page with the following:
· Title of paper in bold font
· Space should appear between the title and the rest of the information on the title page.
· Student’s name
· Name of institution (The University of Arizona Global Campus)
· Course name and number
· Instructor’s name
· Due date
· Must utilize academic voice. See the 

Academic Voice

Links to an external site.
 resource for additional guidance.

· Must include an introduction and conclusion paragraph. Your introduction paragraph needs to end with a clear thesis statement that indicates the purpose of your paper.
· For assistance on writing 

Introductions & Conclusions

Links to an external site.
 and 

Writing a Thesis Statement

Links to an external site.
, refer to the Writing Center resources.

· Must use at least three scholarly sources in addition to the course text.
· The 

Scholarly, Peer-Reviewed, and Other Credible Sources

Links to an external site.
 table offers additional guidance on appropriate source types. If you have questions about whether a specific source is appropriate for this assignment, please contact your instructor. Your instructor has the final say about the appropriateness of a specific source.

· To assist you in completing the research required for this assignment, view the 

Quick and Easy Library Research

Links to an external site.
 tutorial, which introduces the University of Arizona Global Campus Library and the research process, and provides some library search tips.

· Must document any information used from sources in APA Style as outlined in the Writing Center’s 

APA: Citing Within Your Paper guide.

Links to an external site.

· Must include a separate references page that is formatted according to APA Style as outlined in the Writing Center. See the 

APA: Formatting Your References List

Links to an external site.
 resource in the Writing Center for specifications.

Film I chose is Boyz n the hood

What role do you think psychologists can play in promoting preventive interventions and helping individuals stay healthy? How can their expertise contribute to addressing challenges and obstacles to maintaining a healthy lifestyle?

 In response to your peers, please aim for at least one paragraph that provides additional information, a different perspective, or a follow-up question related to their post. Maintain a respectful and supportive tone, acknowledging and appreciating their contributions. The goal is to engage in a collaborative learning environment, allowing everyone to explore the topic further and deepen their understanding of the subject matter. 
 
1#  I think it is pretty important for psychologists to treat and help people stay healthy in many scenerios. While I don’t believe that psychologists should be primary care doctors or anyhting, I think that they can be very helpful in noticing and helping prevent future problems that may arise that are noticed during sessions. They should always be trying to promote healthier routes for their clients and suggest changes that may help them out in the long run. When the health problems seem to stem from psychological related issues is I think when it is really important for psychologists to be able to truly try and help out. 
       There can be numerous things that make it hard for people to try and stay “healthy”. Many people may feel like they lack the time to go out and be active and try and stay in shape, while others may feel like trying to be healthy is just too much and overwhelming. (Alexander 2020) These can have negative affects on the mind and make it hard for people to stay healthy or even try to in their standards. Being in a state of learned helplessness may only make matters worse because someone may not even try to make changes when it is entirely possible to. Things so simple as just taking a walk can be difficult as they don’t feel like they can control anything that happens to them. 
       Some things that I like to do to try and stay healthy and in shape are going for brisk walks around sunset right after I eat dinner, and taking some time for myself mentally at the end of each day, or in the morning before I begin my day. These help me feel more in control of what I do and make me feel as if I have purpose and self care in life. Another thing I do to try and stay healthy is join some recreational adult sports leagues to just keep in shape and have fun while doing it. 
 
2# Psychologists play a crucial role in treating mental health problems and promoting overall well-being. Additionally, their efforts to prevent problems and help people stay healthy are equally important. One research article that supports this idea is “The Prevention of Mental Disorders in School-Aged Children: Current State of the Field” by Fazel, Hoagwood, Stephan, and Ford (2014). The article highlights the significance of preventive interventions in schools to address mental health issues among children and adolescents. Challenges to staying healthy can vary among individuals, but two common obstacles are lack of motivation and limited access to resources. Motivation can diminish when individuals feel overwhelmed or lack a clear understanding of the benefits of healthy habits. Limited access to resources, such as healthy food options or safe exercise environments, can also hinder efforts to stay healthy. Learned helplessness can indeed make it harder to stay healthy. When individuals believe they have no control over their health outcomes, they may feel discouraged and less likely to engage in healthy behaviors. This mindset can lead to a lack of initiative to make positive changes and maintain a healthy lifestyle. Another obstacle to staying healthy is the presence of unhealthy environmental cues. Surroundings that promote unhealthy habits, such as easy access to junk food or a sedentary lifestyle, can undermine efforts to stay healthy. The constant exposure to such cues can create a challenging environment that makes it harder to adopt and maintain healthy behaviors. To stay healthy, individuals can consider incorporating two strategies: regular physical activity and maintaining a balanced diet. Engaging in regular exercise has been extensively studied and shown to have numerous physical and mental health benefits. It can help manage weight, reduce the risk of chronic diseases, improve mood, and enhance overall well-being. Similarly, maintaining a balanced diet that includes nutrient-rich foods supports optimal health and can prevent various health conditions. Practicing mindfulness meditation is a strategy that many people find beneficial for their well-being. Research suggests that mindfulness meditation can reduce stress, improve focus, and enhance overall mental health. Numerous studies have shown its effectiveness in reducing anxiety, depression, and improving overall psychological well-being. Every individual’s experiences may vary, and it’s always recommended to consult with healthcare professionals for personalized advice.
Question: What role do you think psychologists can play in promoting preventive interventions and helping individuals stay healthy? How can their expertise contribute to addressing challenges and obstacles to maintaining a healthy lifestyle?

Compare and contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.

Essay
Your first research essay should be a fully completed work of 5 pages (
Body Paragraphs, NOT including Title or Reference Page, or any graphics). Your topic may be related to the development of any idea that has already been expressed as part of the course; your thesis should be a synthesis of carefully documented research and critical analysis of this topic. The essay should incorporate the general parts of an academic essay—an introduction and thesis, a body of specific evidence/support/analysis, and a conclusion that emphasizes the answers to questions you may have asked within your research.

Your writing should address the Core Learning Outcomes of the course and the Instructor Specific Learning Outcomes, as specified on the syllabus. I have included them here for your convenience:
1. Analyze the disciplinary content in its own context and in relationship to the issues, questions, and positions of other disciplines.
2. Compare and contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.
3. Synthesize diverse perspectives to achieve an interdisciplinary understanding.
4. Analyze the relationships among academic knowledge, professional work, and the responsibilities of local and global citizenship.
5. Interpret and critique the possible “real world” connections or behaviors associated with the viewing or playing of media violence.
Instructor Learning Outcomes
1. Identify, discuss, and critique the representations of serial killers as heroes, celebrities, and icons in modern media forms. Explain the characteristics of the media forms, genres, and methods for each subject.
2. Describe and analyze the popular culture forms that encourage audience identification or participation through violence or vicarious experience.
3. Evaluate multiple perspectives, modes of inquiry and expression, and processes for decision-making in the disciplines.
Specifics
Your essay should conform to the MLA format for citations within the text and in your works cited. Therefore, your writing should be double-spaced, with one-inch margins, in a 10-12-pitch font. The grading of this essay will be based upon the objective skills we have focused upon in our course lectures and discussions—incorporating your research sources seamlessly within your own writing, building upon your skills as a “close-reading” expert, and analysis of your topic, and answering the larger questions about “why” we are studying serial killers as heroes (as well as, “why” your topic is popular? important? significant? worthy of study? definitive of its audience?)
Resources
You should carefully construct your essay by looking at the examples we have studied within our course—the popular culture essays that have been part of your reading assignments, our in-class examples, and the writing process that has been investigated in our class assignments (Reader Response Essays, Discussion Postings, etc.).

This is an enhanced, clearer version of the instructions from the Week 8 Module. Clarifications from me are in brackets/blue and important points are bolded. You should start planning this essay NOW to avoid stress and frustration. Working in “small bites” is always the best way to approach large projects.

Assignment

Paper: Your Final Research Essay should be a
fully completed work of 5 pages [
body only – NOT including Title Page, Sources, graphics/charts or other elements]. Your topic may be
related to the development of any idea that has already been expressed as part of the course [you can write about
anything –
your choice – as long as it’s
related to the class materials and topics. Think about what interested you particularly and if you have questions, send the idea to me and I’ll be happy to review it].

Ideas were provided for the
Midterm that would work here (though you
cannot
rehash your Midterm). You can choose from any of the materials/subjects from Weeks 1-7 for this essay, not only the first three weeks. Craft these example prompts in a way you want with the subjects you want and you will have a topic. You can, of course, develop your own topic and approach.

Example questions/topics from Midterm instructions:

· You may
compare and contrast the way
literary analysis would analyze 
Darkly Dreaming Dexter [or any novel]
differently than
a film analysis would be of the TV series [or movie].  How does Dexter’s “heroic” vigilantism bleed into the real world?

· You may
compare or contrast the film analysis of Alfred Hitchcock’s 
Psycho with the
medical or psychological diagnosis of Norman Bates.  Is it possible to learn from the film’s fiction to allow us to see a “real world” perspective on serial killers?

· How would a
criminal justice perspective on Hannibal Lecter differ from a
social psychological profile?  How does our academic knowledge change our viewing of the film? 

Other options could be analyzing how the movies/ TV series or novels were reviewed, analysis of characters or other elements, the connection between the fictional characters and real-life criminals (who were often the basis for the fictional characters), WHY the market for anything “serial killer related” is so huge or anything else you want to explore. Do not forget to start with a
Research Question about your topic, the
answer to which (through research) will be your
Thesis Statement.

Your
Thesis Statement should be a
synthesis of carefully documented research and critical analysis of this topic. Note that the Thesis Statement is an assertive
statement and
never
a question. The essay should
incorporate the general parts of an academic essay—an Introduction and Thesis, a body of specific evidence/support/analysis, and a conclusion that emphasizes the answers to questions you may have asked within your research.

Your writing should address the
Core Learning Outcomes of the course as specified on the syllabus.

I have included the Outcomes here for your convenience [include/demonstrate as many as you can]:
1.
Analyze the disciplinary content
in its own context and in relationship to the issues, questions, and positions of other disciplines.

2.
Compare and
contrast differences and similarities among the disciplines in terms of central concerns, values, methodologies, and relationships to public life.

3.
Synthesize diverse perspectives to achieve an interdisciplinary understanding.

4.
Analyze the relationships among
academic knowledge, professional work, and the responsibilities of local and global citizenship.

5.
Interpret and critique the possible
“real world” connections or behaviors associated with the viewing or playing of media violence.

Instructor Learning Outcomes:

1.
Identify, discuss and critique the representations of serial killers as heroes, celebrities, and icons in modern media forms. Explain the characteristics of the media forms, genres, and methods for each subject.

2.
Describe and analyze the popular culture forms that encourage audience identification or participation through violence or vicarious experience.

3.
Evaluate multiple perspectives, modes of inquiry and expression, and processes for decision-making in the disciplines.

Specifics

Your essay should conform to the
MLA format [I’ll also accept APA – just make sure you don’t mix the styles] for
citations within the text and in your
Works Cited [or Reference]
Page. Therefore, your writing should be double-spaced, with one-inch margins, in a 10-12-pitch font. The grading of this essay will be based upon the objective skills we have focused on in our course lectures and discussions—incorporating your research sources seamlessly within your own writing, building upon your skills as a “close-reading” expert and analysis of your topic, and answering the larger questions about “why” we are studying serial killers as heroes (as well as, “why” your topic is popular? important? significant? worthy of study? definitive of its audience?)

Resources

You should carefully construct your essay by looking at the
examples we have studied within our course—
the popular culture essays that have been part of your reading assignments, our in-class examples, and the writing process that has been investigated in our class assignments (Midterm Essay, Discussion Postings, etc). [You can include any of the sources I’ve posted in
Discussion or
Doc Sharing or any other
credible sources you find on your own]. Below are links to information on the two styles:

MLA

APA

This exercise should help you see how this tool can be applied to forensic and paternity testing. The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

Lab 10: Paternity Testing with DNA Fingerprinting

Name: ____________________

Introduction

DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.
The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.
1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
2. You have been given the following DNA samples:

Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG

Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG

Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG

Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary’s DNA as an example.
4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.
5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?
6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.
7.
8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.
9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?

10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood.  A. What is your plan? This is a shelter in place scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.

See Rubric for additional details.

Your paper should address the following:

Title Page

Introduction – Family Disaster Plan Scenario

A. You must include research on the dangers and explain the recommended safety measures in a tornado emergency.

How would you prepare for the following situation?

(Scenario) At this moment, you are sitting at home working on your WCU class. Suddenly, the National Weather Bureau sends an alert across your cell phone—a tornado is headed your way. You have 15 minutes before touchdown in your neighborhood. 

A. What is your plan? This is a ‘shelter in place’ scenario, you cannot outrun the tornado. Identify a safe place in your home (residence) to take shelter.
B. Provide realistic examples and explain how you would apply the safety and survival measures you learned in your research of a tornado emergency to your specific living arrangements.

Example: “I will turn off my utilities before I shelter in place to mitigate damage to my residence.”

Example: “I will take by “go-bags” with me to my shelter in place.

How prepared are you in the event of a disaster?

A. Describe your level of disaster preparedness using specific examples and references to:
1. Potential disasters in your area.
2. Your 72 hour “go-bag” assignment.
3. Family Disaster Plan Checklist.

Example: “I am more prepared for a water-related disaster than a fire-related disaster even though I live in a highly secluded, forested area. I have a boat as transportation in the event of flooding, but I do not have rain barrels or fire barrier supplies on hand.”

Example:  “There were many missing items on my preparedness checklist. I realized that I do not own a flashlight. If I had to use my phone as a light it would drain the battery very quickly. 

Reflection/Conclusion

A. Reflect on how prepared you were before this class and compare it with how prepared you are now. 
· Have you acquired any new emergency items?
· Do you plan to take any additional training or certification courses?
· Have you shared your knowledge with friends and family? 
B. How does what you have learned in this course impact you as a future nurse?

Reference Page

A. Cite and reference at least two (2) scholarly resources using 7th ed APA format.
· Need help with APA Style?  Visit the 

Student Resources
 page

.

2

Real due | Nursing homework help

Name: Linda McCarthy
Age: 86 years
Provider: K. Townsend MD
Codestatus: DNI
BMI: 24.1
Allergies: penicillin, atorvastatin, red dye, latex
Admitweight: 145 lbs (65.8kg)

Linda McCartchy had a rough night. She was pretty restless and only slept two hours.
This morning she was having an issue with her hearing aids not working. They kept
whistling. I went to change the batteries, but she was out of them. Her family will be
bringing them in later today.

Nursing Assessments and notes

11/1
0700

Neuro/Cognitive: Alert and oriented to person and place. She intermittently
confused and called staff by the names of her children. Speech raspy. 4/5
strength in all extremities.
Cardiovascular: S1 and S2 heart sound present. Heart rate regular and even.
No edema was noted. Pedal pulses +2, radial pulses +3. Capillary refill less
than 3 seconds.

Respiratory: Even, regular, unlabored. Lung sounds wheezing through all
lung fields. Chronic dry cough. Wears 2 L via nasal cannula chronically.

Gastrointestinal: BS present x 4 quadrants. Abdomen soft, non-distended,
non-tender. Last bowel movement 2 days ago.

Genitourinary: Occasional stress incontinence.

Integumentary: Scattered bruising. Various stages of healing.

Sensory: Hard of hearing. Wears hearing aids and glasses.

11/1
0730

ADLs: Independent with utensil holders
Activity: Ambulated 100 feet with a roller walker

11/1
0830

Nursing Note: Client resting quietly in bed. Looking out the window, not
responding to staff prompts for verbal interaction. Moves all extremities
appropriately. Morning medications were administered without difficulty. Able
to state name but unsure of her birthday. Up in the hall with physical therapy.
Shuffling gait with use of a rolling walker.

11/1
1100

Nursing Note: RN called to bedside. The client stated that the staff took her
favorite earrings. Earrings were found in the client’s tissue box at the bedside.

11/1
2015

Nursing Note: Client evening hygiene offered. The client begins yelling, “No!
No! No!” as staff offer to assist with teeth brushing and denture care. Attempts
were made to deescalate the client and place her hearing aids so that she
could hear the conversation. The client begins attempting to hit and bite staff.
Client sitting in bed. Staff leave room to reduce stimulation.

11/1
2015

Neuro/Cognitive: Alert, oriented to self only. She believes it is 1965 and that
there are strangers in her house. Client calling out for her mother. Extremely
hard of hearing with hearing aids in place.

11/2
0700

Nursing Note: The client is awake in bed, staring around her room, rubbing
her eyes, and frequently yawning. Noted to have redness and purulent
drainage from right eye. Provider notified; prescriptions received.

11/2
0900

Nursing Note: Appetite poor, ate 5 small bites only, Drank a cup of juice.
Weight down. Will encourage protein supplement drinks between meals.

Date Intake Source & Amount

11/1 0700 Oral 240 mL

11/1
0900

Client Information:
Medical History: Presbyopia, bilateral cataracts, Alzheimer’s dementia,
hearing loss, hypertension, hyperlipidemia, osteoarthritis, ambulatory
dysfunction, chronic obstructive pulmonary disease

Medications:
? Rivastigmine 6 mg by mouth twice daily
? Lisinopril 20 mg by mouth daily
? Ezetimibe 10 mg by mouth daily
? Simvastatin 40 mg by mouth daily
? Docusate sodium 100 mg by mouth daily
? Polyethylene glycol 17 g by mouth daily – diluted in 8 oz of beverage
? Duloxetine 60 mg by mouth daily
? Artificial tears 1-2 drops into eyes PRN for dry eyes
? Oxygen 2L/NC PRN for difficulty breathing

11/2 0730 Prescriptions:
? Ciprofloxacin ocular ointment 0.5-inch right eye three times

daily

What are the differences between the ads from other countries and the United States? What are the similarities between the ads from other countries and the United States?

BeautyStandards.docx

Beauty Standards

So often, it is easy to think that everyone else sees the world in the same way that we do. It is often a surprise when we discover the differences.

Resources

Internet search engine such as google, yahoo, etc.

The Prompt

For your initial prompt on this discussion board, please use the internet to research current advertisements from other countries around the world, and compare these ads to those we see in the United States.  You will need to respond to the following three questions, at a minimum.
What are the differences between the ads from other countries and the United States?
What are the similarities between the ads from other countries and the United States?
How are beauty standards portrayed in advertising different when comparing other countries to the United States?
Please reference your ads at the end of your post.

Discussion Forum Grading Criteria

The Discussion Forum (DF) represents your class participation.  Your performance will be evaluated on the quality of your initial input and then on your responses to other students input.  It is highly suggested that students post their responses early in the week in order to allow students to have someone to respond to. Failure to post your initial response to the question by
 Friday will result in -10 points per day for each day after. 
For instance if you make you main post on Sunday, and respond to two classmates with all of the requirements met, the highest grade that you can earn is a 70 for that particular discussion board.

Quality primary input–
Your initial post will count as 80%.  Primary input should be  thorough and direct and posted no later than Friday. Quality primary input should be complete, thoughtful, and well-developed responses that are substantive and may contain specific text references.  Students should refrain from personal opinions unless it is based upon objective facts. It must be detailed; at least two paragraphs (5-7 sentences each). If there is more than one part to a question, you must answer all parts of the question.

Provide a brief summary of your chosen project that includes a beginning and an end, results in something being delivered to someone requires a series of activities that must be done to complete the project and requires resources.nd

 Overview
This is the first of three assignments that, as a whole, will cover all aspects of the project life cycle relevant to your selected project. You will select your project to use throughout the remaining assessments allowing you to build on your project plan from beginning to end.
Scenario
Provide a brief summary of your chosen project that includes a beginning and an end, results in something being delivered to someone requires a series of activities that must be done to complete the project and requires resources.In addition, the project should?meet the key criteria of a project, such as:

Has?a beginning and an end. (For example, the project begins on January 15 and ends at midnight on January 30).
Results in something being delivered to someone (ensuring your end-user agrees with expectations and you deliver those expectations).
Requires a series of activities that must be done to complete the project (develop WBS with timelines and deliverables).
Requires resources (e.g., people, materials, training, or tutorials) to complete the work.

Note: You are prohibited from using projects that can be found on the Internet, including projects found in places like CourseHero. All project submissions are submitted to SafeAssign for review.
Instructions
Write a 2-3 page paper in which you define the scope of your chosen project. In your paper you must:

Provide a brief summary of your chosen project that includes a beginning and an end, results in something being delivered to someone requires a series of activities that must be done to complete the project and requires resources.
Describe at least three project goals or objectives. All goals or objectives should provide information on how you will confirm whether the goals or objectives can be met.
Describe the key customers and at least two?stakeholders for your project. Remember, you are delivering the project to your customers; however, there are others (stakeholders) who have a vested interest in your project.
Describe at least three key milestones and three deliverables for your project and describe what makes them key.
Create a depiction of a high-level timeline that includes key tasks and deadlines.
Provide timelines for each milestone and identify potential roadblocks and mitigation efforts. Include rationale for the chosen timeline and potential roadblocks to meeting deadlines.
List each of the project’s key staffing and non-staffing resources needed and their estimated costs along with an estimate for the overall cost of the project. All estimates should reflect current market pricing.
Use at least three sources to support your writing. Choose sources that are credible, relevant, and appropriate. Cite each source listed on your source page at least one time within your assignment. For help with research, writing, and citation, access the?library?or review?library guides.

This course requires the use of Strayer Writing Standards (SWS). The library is your home for SWS assistance, including citations and formatting. Please refer to the Library site for all support. Check with your professor for any additional instructions.
The specific course learning outcome associated with this assignment is:

Evaluate corporate strategy and the project life cycle phases to define the project and initiate a project plan.

Edmg541wk3 | Law homework help

Mass-Casualty Incident Management: Clinical Issues
In Week 3 we examine logistical, organizational, and communication issues in the clinical management of Mass
Casualty Incidents.

When we think of clinical issues, we must start at the event site and work our way to recovery. To do this, we will have
a network of paths that will work independently and interdependently to recover patients, scene, community, and
disaster responders.

From a scene perspective, we now have fire, EMS, and police, as well as the potential for nurses and doctors to all
converge upon the scene and operate to rescue, treat, and transport mass casualty victims. As noted in content 2, this
organization will occur under the ICS system, but because we can have physicians, nurses, and other medical
professionals working in the field, the protocols and medical actions may contraindicate the normal ICS structure and
pre-arranged protocols utilized by police, fire, and EMS. This coordination will become important as decisions made at
the scene will have downstream effects on hospitals, police investigations, and community recovery efforts.

Currently there are various thoughts on where the centralization of command should reside in a mass casualty event.
This is further complicated by the use of unified command needed for active shooter/active violence events. The best
practice involves the use of an emergency operations center to allow coordination of the various centralized command
structures that will exist at the scene, in the hospitals, and in community government. Attendance at the FEMA G191
EOC/ICS interface course can help to understand the coordination needed to keep all parts of a mass casualty
coordinated.

Patient Flow issues are related to surmounting a large patient influx and the communication process necessary to
determine resource allocation and forecast patient volumes. The knowledge of patient flow patterns is critical to
disaster planning. Recent funding challenges due to no elective surgeries have places some hospitals in a position that
creates subpar staffing daily.

In Mass Casualty Incidents, the creation of the Discharge Unit should be on the same level of importance as the
delineation of the Command Center. Without the Discharge Unit the patients will languish and the hospital will
compromise the ability to provide further care for incoming patients. In a disaster, no patient should leave the hospital
without passing through Discharge unit.

Without a properly planned physical plant design for the emergency department, the performance of a successful
disaster mitigation strategy is challenged. Failure to take the special requirements for Mass Casualty Incidents into
account will present unanticipated problem when a Mass Casualty Incident occurs. The key in disaster management
architectural planning is whiter the proposed design will allow for appropriate patient flow.

The new information management systems enhance patient management and allow hospitals and other health care
and emergency services provides to communicate with hospital core Health Information System. It also enable the
implementation of the National Network for Real-time Syndromic and Bioterrorist Surveillance Systems.

Victim lists are essential tools for hospital response. Victim lists are required, not only to identify victims that have
come into the hospital but also to identify casualties brought to multiple other sites during a disaster. Lists are often
electronic in nature and require the systems to function at the time of a disaster. Plan accordingly.

International trade has been a great boon for many countries and, in general, has been more beneficial for the world than not.discuss two advantages of international trade and two disadvantages of international trade

(International trade): International trade has been a great boon for many countries and, in general, has been more beneficial for the world than not.discuss two advantages of international trade and two disadvantages of international trade. However, there are both costs and benefits associated with international trade. Present and discuss two advantages of international trade and two disadvantages of international trade.

Develop a response that includes examples and evidence to support your ideas, and which clearly communicates the required message to your audience. Organize your response in a clear and logical manner as appropriate for the genre of writing. Use well-structured sentences, audience-appropriate language, and correct conventions of standard American English.

ASSIGNMENT 2

(Unemployment): Here are four individuals telling you their stories of how they became unemployed. In a multi-paragraph essay, apply the theories of unemployment to explain the type of unemployment that each of these individuals is facing and explain which of these individuals qualifies for unemployment benefits:

1) Two months ago, Marcelle used to work full time in an automobile manufacturing firm. “The factory where I used to work has closed because our market contracted so much, and so I was laid off. This is happening to people all over the country-all you see in the papers is that economic growth has fallen and incomes across the country have fallen. I have been looking very hard for a new job, but have had no luck yet.”
2) Until last week, Dominic used to work full time as a hair-dresser in downtown Cincinnati. “I decided to quit my job, because I want to move to New York City.”
3) Until last month, Francine worked part time at a ski resort. “Well, it is summer now, and so the resort is closed. I will apply again in the winter when the snow is back. I am not interested in working until then.”
3) Two months ago, Beauvoir had been working full time as a secretary. “I was a good typist, but I don’t know how to use a computer. My boss wanted to upgrade the office to computers, and so I was replaced by someone who is computer-savvy. I have been looking for another job, but it appears that I need to learn some computer skills.”

Develop a response that includes examples and evidence to support your ideas, and which clearly communicates the required message to your audience. Organize your response in a clear and logical manner as appropriate for the genre of writing. Use well-structured sentences, audience-appropriate language, and correct conventions of standard American English.

× How can I help you?